R.A. Mumford*, B. Jarvis and A. Skelton

Central Science Laboratory, Sand Hutton, York, YO41 1LZ, UK

*r.mumford@csl.gov.uk

Accepted for publication 15/12/03

In July 2003, samples were received from a glasshouse tomato crop growing in south east England. The samples were sent following the appearance of virus-like symptoms in a small number of plants of variety 'Passion'. The affected plants were showing a range of symptoms including yellowing, leaf curling and epinasty (Fig. 1), in addition to whole plant stunting and bunching of stems in the crown ('bunchy top') (Fig. 1). Given the symptoms, the samples were tested for Potato spindle tuber viroid (PSTVd) using a TaqManâ RT-PCR assay (Mumford et al.., 2000) and all samples tested positive. The samples were also found to be ELISA positive for Pepino mosaic virus (PepMV), which had been identified in the crop some months earlier. To confirm the TaqManâ results, certain samples were tested further by RT-PCR using primers known to detect a range of different pospiviroids (Mumford et al., 2000; Mumford, 2002) and a product of the predicted size (264 bases) was obtained. Using RT-PCR with a second primer set (PSTVd 133F CCCACCGCGCCTTTTGCCAG and PSTVd 134R GAGTGCCTCGCGGCCGAG), a full length product of 358 bases was obtained. This was sequenced (Acc. No. AJ583449) and shown to share very high sequence similarity (over 89%) with all published PSTVd sequences. The closest homology (99.4% similarity) was with an isolate recently identified in tomato from New Zealand (Acc. No. AF369530).

Figure 1: PSTVd symptoms from the UK outbreak site, showing bunching of stems ('bunchy top') and yellowing in the crown (left), with a close up showing severe yellowing and leaf curling (right). Images courtesy of Peter Reed, CSL.

Following confirmation of PSTVd infection, extensive screening of the crop was carried out both by visual assessment and laboratory testing. In total around 80 infected plants were identified as being PSTVd-positive, within an area of the crop containing around 69,000 plants. The origin of the infection is unknown. The crop has now been removed and measures taken that have eradicated the infection.

While PSTVd has previously been found under controlled conditions in a potato germplasm collection in the UK (Cammack & Harris, 1973), this is the first report of an outbreak in a commercial crop.

Cammack RH, Harris PS, 1973. Potato spindle tuber in the Commonwealth Potato Collection. EPPO Bulletin 3, 117-118.

Mumford RA, 2002. Protocols for the diagnosis of Quarantine pests: Chrysanthemum stunt viroid. EPPO Bulletin 32, 245-253.

Mumford RA, Walsh K, Boonham N, 2000. A comparison of molecular methods for the routine detection of viroids. EPPO Bulletin 30, 431-436.

The British Society for Plant Pathology