R.K. Jain¹*, S. Bag¹ and L.P. Awasthi²

¹ Unit of Plant Virology, Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi, India
² Department of Plant Pathology, N. D. University of Agriculture & Technology, Kumarganj, Faizabad, India

*rakeshjain56@yahoo.co.in

Accepted for publication: 17/09/04

In February 2004, chilli (Capsicum annuum) plant samples exhibiting necrosis of leaves and buds (Fig.1) were collected from the farmers' fields around Faizabad, Uttar Pradesh and were subjected to immunoassay. Extracts from the field samples reacted only with polyclonal antiserum raised against the coat protein (CP) of a Tobacco streak virus (TSV) isolate from India (TSV-SF) (Ramiah et al., 2001) in direct antigen-coated enzyme-linked immunosorbent assay (A405 nm: 0.24-0.57). 

Figure 1: Chilli plant showing necrosis on leaves

The identity of the virus associated with chilli was further confirmed by reverse transcription-polymerase chain reaction and sequence analysis (Bhat et al., 2002a). By using TSV specific primers (5'ATGAATACTTTGATCCAAGG3' and 5' TCAGTCTTGATTCACCAG3'), the CP gene was amplified and sequenced (GenBank Accession No. AY590139). The CP gene was 717 nucleotides long and could encode a protein of 238 amino acids. Comparative amino acid sequence analysis revealed that the virus infecting chilli shared very high levels of similarity both at nucleotide (98-99%) and amino acid (98%) levels with the corresponding region of TSV isolates originating from multiple hosts and locations (Bhat et al., 2002b), suggesting that the virus infecting chilli is a strain of TSV and be designated as TSV-CH. To our knowledge, this is the first report of natural infection of chilli pepper by TSV in parts of northern India.

Bhat AI, Jain RK, Kumar A, Ramiah M, Varma A, 2002a. Serological and coat protein sequence studies suggest that necrosis disease on sunflower in India is caused by a strain of Tobacco streak Ilarvirus. Archives of Virology 147, 651-658.

Bhat AI, Jain RK, Chaudhary V, Krishna Reddy M, Ramiah M, Chattannavar SN, Varma A, 2002b. Sequence conservation in the coat protein gene of Tobacco streak virus isolates causing necrosis in cotton, mungbean, sunflower and sunn-hemp in India. Indian Journal of Biotechnology 1, 350-356.

Ramiah M, Bhat AI, Jain RK, Pant RP, Ahlawat YS, Prabhakar K, Varma A, 2001. Partial characterization of an isometric virus causing sunflower necrosis disease. Indian Phytopathology 54, 246-250.

The British Society for Plant Pathology