The presence of both recombinant and the non-recombinant strains of Tomato yellow leaf curl virus on tomato in Réunion Island

H. Delatte¹*, H. Holota¹, F. Naze¹, M. Peterschmitt², B. Reynaud¹ and J.M. Lett¹

¹ CIRAD, UMR PVBMT CIRAD-Université de La Réunion, Pôle de Protection des Plantes, Ligne Paradis, 97410 Saint-Pierre, La Réunion, France.
² CIRAD, UMR BGPI, TA 41/K, 34398 Montpellier Cedex 5, France.

*helene.delatte@cirad.fr

Accepted for publication 22/11/04

Tomato yellow leaf curl virus (TYLCV) was first detected in Réunion in 1997, based on symptoms and partial sequence data between the conserved nonanucleotide and the first 5’ quarter of the capsid protein (CP) gene (Peterschmitt et al., 1999). A 516bp portion of the C4 gene of the same isolate of TYLCV from Réunion was subsequently sequenced (Acc. No. AJ842312) showing that it belonged to the mild strain (TYLCV-Mld[RE]) and the so-called non-recombinant group (Navas-Castillo et al., 2000).

In April 2004, strong symptoms of stunting, yellowing and leaf curling, resembling the symptoms of tomato yellow leaf curl disease, were observed on tomato plants in Saint Gilles, in the North West region of Réunion (Fig. 1). Twenty two symptomatic leaf samples of tomato plants were collected and tested for the presence of begomoviruses using a polymerase chain reaction (PCR) assay with two sets of primers designed to amplify two regions of the A component of TYLCV: primers V2790 and C837 amplify a 800bp fragment spanning the intergenic conserved region (IR) nonanucleotide sequence and two thirds of the CP gene, while primers TY1944 (TTGTTTTGCCTGTTCTGCTA) and TY2460 (CATCTCCATGTGCTTATCCA) amplify a 516bp portion of the C4 gene. The latter region was chosen to differentiate the Israeli strain (syn. TYLCV [Israel]; Acc. No. X15656) from the mild strain (TYLCV-Mld; Acc. No. X76319).

Figure 1: Tomato yellow leaf curl disease symptoms observed on tomato plants in April 2004 at Saint Gilles, on newly planted seedlings (A) and old plants (B).

All of the leaf samples produced PCR products of the expected size with both sets of primers. For three samples a 483bp fragment of the C4 gene was sequenced using the primer set TY1944/TY2460 (Acc. Nos AJ842309, AJ842310 and AJ842311) and a 685bp fragment of IR/CP region was sequenced using the primer set V2790 (ATCCGTATAATATTACCGGATGG ) and C837 GCAAATCATTCTTCACTGTTGC) (Acc. Nos AJ842306, AJ842307 and AJ842308). The sequences were aligned with those of known TYLCV strains using DNAMAN (Lynnon Biosoft, Quebec). The 685bp fragment showed 98% to 99% nucleotide identity with TYLCV, TYLCV-Mld and -Mld[RE]. However, the 483bp fragment showed a 98% nucleotide identity with TYLCV, but only 77% nucleotide identity with TYLCV-Mld and the previous Réunion isolate TYLCV-Mld[RE]. This is the first report of the presence of the Israeli strain, which belongs to the so-called recombinant group of TYLCV, from Réunion island.

Acknowledgements

This study was funded by the Conseil Régional de La Réunion. The technical assistance of M Grondin is acknowledged.

References

Peterschmitt M, Granier M, Mekdoud R, Dalmon A, Gambin O, Vayssières JF, Reynaud B, 1999. First report of tomato yellow leaf curl virus in Réunion island. Plant Disease 83, 303.

Navas-Castillo J, Sanchez-Campos S, Noris E, LouroD, Acotto GP, Moriones E, 2000. Natural recombination between Tomato yellow leaf curl virus-Is and Tomato leaf curl virus. Journal of General Virology 81, 2797-2801.

The British Society for Plant Pathology