|
First reports of two grapevine viroids in China and the possible detection of a third Shi-fang Li1 *, Rui Guo1, Masaharu Tsuji2 and Teruo Sano2 1 State key Laboratory of Biology for Plant Diseases and Insect
Pest, Institute of Plant Protection, Chinese Academy of Agricultural
Sciences, Yuanmingyuan west ro2 100094, Beijing, P.R. China Accepted for publication 08/12/05 Five distinct viroids have been recognised in grapevine (Vitis vinifera) by sequence analysis (Hadidi et al., 2003). Grapes are one of the most important fruit crops in China and a survey was conducted during 2002-2005 to identify those viroids affecting this crop in the country. Leaves were harvested in June from 70 samples, comprising seven wild plants from Liaoning, 58 varieties in a grapevine nursery in Beijing, two from Xinjiang autonomous region and three from Hebei. Nucleic acids were extracted (Li et al., 1995) and tested for the presence of four grapevine viroids by dot-blot or northern hybridisation using digoxygenin-labeled riboprobes for Hop stunt viroid (HSVd), Apple fruit crinkle viroid (AFCVd), Grapevine yellow speckle viroid (GYSVd) and Citrus exocortis viroid (CEVd) (Li et al., 1995, Sano et al., 2000, Sano et al., 2004). HSVd was detected in 41 samples, GYSVd in 29 and AFCVd in one. CEVd was not detected. As AFCVd has never been reported from grape and the probe shared ca.85% sequence similarity with Australian grapevine viroid (AGVd), the latter sample seems more likely to have been infected with an AGVd-like viroid. Twenty three samples were infected with both HSVd and GYSVd, and one with the AGVd-like viroid, HSVd and GYSVd. This last sample had been collected from an old grapevine in Xinjiang. Infection in 13 samples positive by dot blot hybridisation for HSVd and 12 for GYSVd was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) using the primers 5’-TTGGATCCTCTCTTGA(G/A)CCCCT-3’ and 5’-TTGGATCCGCGGCAGAGGC-3’ for HSVd; and 5’TTGGATCCCACCTCGGAAGGCC(G/T)CC-3’ and 5’TTGGATCC(T/A) AACCACAGGAACCACA-3’ for GYSVd1 and GYSVd2. Identities of the viroids were confirmed by sequencing the PCR products obtained. Infection of the sample positive when using the AFCVd probe could not be confirmed by RT-PCR using the primers 5’-TTGGATCCTGGGCACCAACTAGAGGT-3’ and 5’-TTGGATCCGGGCCTCC AAACAGGGAG-3’ which should detect AGVd. The reason for this failure is not known and at present the identity of the viroid in this sample is uncertain. Further work is necessary to confirm the possible detection of this viroid or to characterize the agent detected by the AFCVd probe. GYSVd has been reported from China previously (Hadidi et al., 2003) but these reports seem to have been based solely on symptoms and this is the first report confirmed by other tests. This is also the first report of HSVd in grapes in China. References Hadidi A, Flores R, Randles JW, Semancik JS, eds, 2003. Viroids. Collingwood, Australia: CSIRO Publications. Li SF, Onodera S, Sano T, Yoshida K, Wang GP, Shikata E, 1995. Gene diagnosis of viroids: Comparisons of return-PAGE and hybridization using DIG-labelled DNA and RNA probes for practical diagnosis of hop stunt, citrus exocortis and apple scar skin viroids in their natural host plants. Annals of the Phytopathological Society of Japan 61, 381-390. Sano T, Yoshida H, Goshono M, Monma T, Kawasaki H, Sano T, Kobayashi T, Ishiguro A, Motomura Y, 2000. Two types of grapevine yellow speckle viroid 1 isolated from commercial grapevine had the nucleotide sequence of yellow speckle symptom-inducing type. Journal of General Plant Pathology 66, 68-70. Sano T, Yoshida H, Goshono M, Monma T, Kawasaki H, Ishizaki K, 2004. Characterization of a new viroid strain from hops: evidence for viroid speciation by isolation in different host species. Journal of General Plant Pathology 70, 181-187. |