Reports Search NDR About NDR Editors Author Info Submission Links

Globularia nudicaulis, a new host for Cucumber mosaic virus

S. Davino1*, S. Cugnata1 and M.G. Bellardi2

1 Dipartimento di Scienze e Tecnologie Fitosanitarie (DISTEF) - sez. di Patologia Vegetale, Università degli Studi di Catania, Via S. Sofia, 100, I-95123 Catania, Italy
2 Dipartimento di Scienze e Tecnologie Agroambientali (DiSTA) - Patologia Vegetale, Alma Mater Studiorum, Università di Bologna, Via G. Fanin, 42, I-40127 Bologna, Italy

*wdavino@unict.it

Accepted for publication 16/12/05

Globularia nudicaulis (family Globulariaceae) is a perennial, found naturally on European mountains at altitudes between 900 and 2000 m. In June 2004, G. nudicaulis plants, with a yellow mosaic and/or variegation on malformed leaves (Fig. 1) were noted among plant species cultivated in the Botanical Garden at Bologna University (Bologna, Italy). 


Figure 1: Globularia nudicaulis naturally infected by Cucumber mosaic virus
showing a yellow mosaic and variegation on malformed leaves.

Symptomatic leaves were collected and analysed for virus infection. No elongated virus-like particles were observed by transmission electron microscopy in leaf extracts using a leaf dip method. By applying a protein A sandwich enzyme-linked immunosorbent assay (PAS-ELISA) technique (Edwards & Cooper, 1985), Cucumber mosaic virus (CMV) was detected using a polyclonal antiserum (PVAS 30, American Type Culture Collection, Manassas, VA, USA). CMV from G. nudicaulis leaves was mechanically transmitted to 10 of 14 species tested. Local lesions were observed in Chenopodiaceae (Chenopodium murale and C. quinoa); systemic symptoms were observed in Solanaceae (Nicotiana tabacum, N. benthamiana, N. glutinosa, N. clevelandii and Capsicum annuum) and Cucurbitaceae (Cucumis sativus and C. melo). Reverse transcription-polymerase chain reaction (RT-PCR) and single strand conformation polymorphism (SSCP) were employed to characterise the CMV isolate. Total RNA was extracted from symptomatic G. nudicaulis leaf samples with a Qiagen RNeasy Plant Minikit (Qiagen S.P.A., Milan, Italy) according to the manufacturer’s instructions. RT-PCR was carried out using specific primers for the movement protein gene of RNA3 of CMV (forward MP+ CATGGCTTTCCAAGGTACCAG, genomic position 118nt to 138nt, and reverse CTAAAGACCGTTAACCACCTGC, genomic position 938nt to 959nt; Lin et al., 2004). All samples yielded DNA fragments of the expected size: 841 bp. PCR products were then analysed by SSCP to identify specific sequence variants and compare genetic relationships with other CMV isolates from the Botanical Garden (Bellardi & Davino, unpublished results). The results showed a sequence variant that was different from other local CMV isolates, indicating that CMV isolate G in G. nudicaulis is a new accession in this Garden. This is the first time that CMV has been isolated from G. nudicaulis.


Reference

Lin HX, Rubio L, Smythe AB, Falk BW, 2004. Molecular population genetics of Cucumber mosaic virus in California: Evidence for founder effect and reassortment. Journal of Virology 78, 6666-6675.

Edwards ML, Cooper JI,. 1985. Plant virus detection using a new form of indirect ELISA. Journal of Virological Methods 11, 309-313. 

The British Society for Plant Pathology