Occurrence of Tomato mosaic Havana virus in Nicaragua

W.A. Monger¹, R.A. Mumford^1*, E. Antonio García² and E. Boa³

*r.mumford@csl.gov.uk

Accepted for publication 06/08/07

Tomatoes (Lycopersicon esculentum) are grown throughout the year in Nicaragua, mainly by smallholders, and are an important cash crop.  In May 2006, severe virus-like symptoms were reported on tomatoes by the plant health clinic (Puesto para Plantas) in San Juan del Río Coco, Las Segovias.  Affected plants occurred in a 1-2 ha field plot.

Figure 1: Foliar symptoms of tomato plants infected with ToMHV	Figure 2: Symptoms on tomato plants infected with ToMHV

Leaf samples collected for analysis had yellow leaf curl and a purple coloration at the edge of laminas.  They tested positive for a begomovirus by ELISA using a broad-spectrum antiserum raised to Tomato yellow leaf curl virus (Cat No. 1072-06; Adgen, UK).  No other viruses were detected by electron microscopy.  The virus also infected Nicotiana benthamiana, producing leaf curling and mosaic symptoms two weeks after mechanical inoculation.  PCR products were generated using generic primers (Deng 540/541 [Deng et al., 1994] and prV324/C889 [primers referenced in Rojas et al., 2000]) to component A of begomoviruses and sequenced.  Specific primers (ToMHV F1 GCAAATACGAGAATCATACTGAG and ToMHV R2 CAATTGTACGGAAAGAGGAAAGG) were designed to obtain the complete sequence of 2619 nucleotides of component DNA A (GenBank EF088197).  The sequence showed 94% nucleotide identity to Tomato mosaic Havana virus (ToMHV) from Cuba (Y14874).  A partial sequence of 1357 bp of this virus from Honduras (AF139078) aligned with 98% identity.  Two small partial sequences from Jamaica (AF035224 and U82829) also aligned with more than 90% identity.  ToMHV was first identified and sequenced in Cuba and found to be a distinct begomovirus (Martinez Zubiaur et al., 1998).

Begomoviruses have been a major constraint to tomato production in Nicaragua since the 1990s.  Two recent surveys of tomatoes in Nicaragua found widespread begomovirus infections, including Tomato leaf curl Sinaloa virus, Tomato mottle virus, Chino del tomate virus (previously known as Tomato leaf crumple virus), Sida golden mosaic virus, Tomato mild mottle virus, Tomato severe leaf curl virus, Pepper golden mosaic virus and Tomato leaf curl Las Playitas virus (Rojas et al., 2000; Ala-Poikela et al., 2005).  However, these surveys failed to detect ToMHV.

References

Ala-Poikela M, Svensson E, Rojas A, Horko T, Paulin L, Valkonen JPT, Kvarnheden A, 2005. Genetic diversity and mixed infections of begomoviruses infecting tomato, pepper and cucurbit crops in Nicaragua. Plant Pathology 54, 448-459.

Martinez Zubiaur Y, de Blas C, Quinones M, Castellanos C, Peralta EL, Romero J, 1998. Havana tomato virus, a new bipartite geminivirus infecting tomatoes in Cuba. Archives of Virology 143, 1757-1772.

Rojas A, Kvarnheden A, Valkonen JPT, 2000. Geminiviruses infecting tomato crops in Nicaragua. Plant Disease 84, 843-846.

Deng D, McGrath PF, Robinson DJ, Harrison BD, 1994. Detection and differentiation of whitefly-transmitted geminiviruses in plants and vector insects by the polymerase chain reaction with degenerate primers Annals of Applied Biology 125, 327-336.