Reports Search NDR About NDR Editors Author Info Submission Links

Sugarcane yellow leaf phytoplasma associated for the first time with sugarcane yellow leaf syndrome in India

R.K.Gaur1* Richa Raizada2 and G.P.Rao3  

1 Department of Biotechnology, Faculty of Arts, Science and Commerce, Mody Institute of Technology and Sciences, Sikar-332311, Rajasthan, India
2
Department of Zoology, D.D.U University, Gorakhpur-273009, Uttar Pradesh, India
3
 Sugarcane Research Station, Kunraghat, Gorakhpur-273008, Uttar Pradesh, India 

*gaurrajarshi@hotmail.com

Accepted for publication 31/01/08

Yellow leaf syndrome (YLS) has been recognized as a relatively new disease of sugarcane (Comstock et al., 1994).  Symptoms consist of yellowing leaves with a bright yellow midrib, often when the rest of the lamina is still green (Fig 1).  Pink colouration may also occur as well as early drying of leaves from the edges.

Figure 1: Typical symptoms of sugarcane yellow leaf phytoplasma in the field (left)
and mid rib yellowing of the leaves while lamina remains green (right)

Initial evidence (Smith et al., 1995) suggested that a previously undescribed Luteovirus, tentatively named sugarcane yellow leaf Luteovirus, was the causal agent of YLS. Later, a phytoplasma was also detected in association with this disease (Cronjé et al., 1998). Rao et al. (2000) reported the presence of this virus in association with sugarcane yellow syndrome in India. Leaf samples of sugarcane showing typical midrib yellowing and apparently healthy (symptomless) plants were collected from the Indian Institute of Sugarcane Research, Lucknow, India.  


Figure 2:  RFLP pattern of 16S rDNA amplified by nested PCR with primer f5U/r3U. Restriction enzymes 1-3 HaeIII and 4-6 HhaI Lane M contain pBR322, DNA MspI digest; the fragment sizes in base pairs (from top to bottom) are 622, 527, 404, 307, 242, 238, 217, 201, 190, 180, 160, 147, 123, 110, 90, 76, 67, 34, 26, 15, and 9.

DNA was extracted and assayed in a nested PCR with phytoplasma universal rDNA primers P1/P7 (P1AAGAGTTTGATCCTGGCTCAGGATT/P7CGTCCTTCATCGGCTCTT) and f5U/r3U(f5UCGGCAATGGAGGAAACT/r3UTTCAGCTACTCTTTGTAACA).  DNA extracts from plants with yellow mid-rib produced products of 1250 bp, which gave profiles consistent with being from a phytoplasma when digested with HaeIII and HhaI (Fig 2).  No PCR amplifications were produced using DNA from symptomless plants.  RFLP analysis of PCR products with HaeIII, and HhaI endonucleases generated fragment profiles that were identical for all the samples. PCR products were purified and sequenced in both directions using primers f5U/r3U. The  16S rRNA sequence of the Indian sugarcane yellow leaf phytoplasma (SCYLP) (GenBank Acc. No. EU170474) showed the closest identity (99%) with that of SCYLP in Cuba identified in Macroptilium lathyroides (AY725233), which belongs to 16SrXII (Stolbur group).  This is the first record of the detection of SCYLP in sugarcane, and the identification of a 16SrXII group phytoplasma associated with YLS in India.


References

Comstock JC, Irvine JE, Miller JD, 1994. Yellow leaf syndrome appears on the United States mainland. Sugar Journal, March Issue, 33-35.

Cronjé P, Tymon A, Jones P, Bailey R, 1998. Association of a phytoplasma with a yellow leaf syndrome of sugarcane in Africa. Annals of Applied Biology, 133, 177–86.

Rao GP, Gaur RK, Singh M, Srivastava AK, Virk AS, Singh N, Patil AS, Viswanathan R, Jain RK, 2000. Occurrence of Sugarcane Yellow leaf virus in India. Sugar Technology 2, 37-38.

Smith GR, Fraser, TA, Braithwate KS, Harding, RM, 1995.  RT-PCR amplification of RNA from sugarcane with YLS using luteovirus group specific primers. Proceedings of the 18th Biennial Australasian Plant Pathology Society Conference, Christchurch, New Zealand, p. 84.

The British Society for Plant Pathology