First Report of Mungbean yellow mosaic India virus on mungbean in Pakistan

M. Hussain¹, J. Qazi¹, S. Mansoor*¹, S. Iram¹, M. Bashir² and Y. Zafar¹

¹ National Institute for Biotechnology and Genetic Engineering, P O Box 577, Jhang Road, Faisalabad, Pakistan
² National Agriculture Research Centre (NARC), Islamabad, Pakistan

*smansoor@nibge.org

Accepted for publication 19/03/04

Mungbean yellow mosaic disease is characterised by a bright yellow mosaic on the leaves of infected plants (Fig. 1) and causes significant losses to mungbean (Vigna radiata L) crops in Pakistan. A bipartite begomovirus named as Mungbean yellow mosaic India virus (MYMIV) is reported to be the causative agent of the disease in India (Pant et al., 2002). The disease has been recorded on mungbean and cowpea in Pakistan but the causal agent was not identified (Bashir et al., 2002).

Figure 1: Typical bright yellow mosaic symptoms
caused by Mungbean yellow mosaic India virus on mungbean.

To identify the begomovirus associated with the disease, and its genomic components, samples of infected mungbean plants with yellow mosaic symptoms were collected from ten distinct locations of the North Western Frontier province and the Punjab province of Pakistan. The strategy for the detection of viral genomic components was based on the assumption that the begomovirus associated with the disease is related to MYMIV. To detect the presence of MYMIV in these samples, primer pair FLDNAAF (TGTG GGATCCATTGTTGAACGACTTTCCC) and FLDNAAR (CAATGGATCCCACATT GTTAGTGGGTTCAG) were designed to amplify full-length DNA A of MYMIV. Similarly, using published sequence of MYMIV DNA B, primer pair BV1F (CAACATCGA TATGTTTACTCGTAATTA) and BV1R (CTTTAGTCGACTTATCCAACGTATTTCAA TT) and primer pair BC1F (TTATTATCGATATGTTACAACACTTTGTT) and BC1R (TTGGGTCGACTTATGATTATAATTGTAAACT) were designed to amplify the nuclear shuttle protein (NSP) and movement protein (MP) genes respectively. All three sets of primers amplified PCR products of the expected size. The PCR product of NSP was cloned into a TA cloning vector and completely sequenced. The nucleotide sequence showed a 94% identity with a MYMIV isolate from mungbean (AF416741), confirming that the bipartite begomovirus associated with the disease in Pakistan is a strain of MYMIV. The NSP primers were used to assess the distribution of MYMIV in Pakistan. PCR products of the expected size were obtained from all symptomatic samples tested, while no amplification product was obtained from healthy controls. The presence of MYMIV was further confirmed by Southern hybridisation using an NSP PCR product as a specific probe. Strong hybridisation signals were observed for all symptomatic samples, when blots were washed at medium to high stringency. These results show that MYMIV is prevalent in Pakistan and are consistent with unpublished sequences of IMYMV DNA A previously obtained from mungbean in Pakistan (Accession numbers AY269990 and AY269992). To the best of our knowledge this is the first formally published report of MYMIV on found on mungbean in Pakistan.

References

Bashir M, Iqbal S, Ghafoor A., Ahmad Z, Qureshi AS, 2002. Variability in Cowpea germplasm for reaction to virus infection under field conditions. Pakistan Journal of Botany 34, 47-48.

Pant V, Gupta D, Choudhury NR, Malathi VG, Varma A, Mukherjee SK, 2001. Molecular characterization of the Rep protein of the blackgram isolate of Indian mungbean yellow mosaic virus. Journal of General Virology 82, 2559–2567.

The British Society for Plant Pathology