Reports Search NDR About NDR Editors Author Info Submission Links

First report of Tomato leaf curl Joydebpur virus and associated betasatellite in kenaf (Hibiscus cannabinus) plants showing leaf curl symptoms from southern India

S. Paul1, R. Ghosh1, S. Das1, P. Palit1, S. Acharyya1, A. Das1, J. I. Mir1, S. Chaudhuri2, S. K. Ghosh1 and A. Roy1* 

1 Plant Virus Laboratory and Biotechnology Unit, Division of Crop Protection, Central Research Institute for Jute and Allied Fibres, Barrackpore, Kolkata-700120, West Bengal, India
2
Department of Botany, University of Kalyani, Kalyani, West Bengal, India

*anirbanroy75@yahoo.com

Accepted for publication 25/04/08

Kenaf (Hibiscus cannabinus, family - Malvaceae) is the second most important bast fibre crop after jute and is cultivated in several states across India. The occurrence of a leaf curl disease (LCD) in this crop, characterized by upward curling of leaves with reduction in plant height, was reported earlier from northern India (Paul et al. 2006). Molecular analysis of this isolate revealed the association of a new monopartite Begomovirus species and a betasatellite with the disease (manuscript submitted). During 2006-2007 a similar leaf curl disease, with an average incidence of 15-20%, was noted on kenaf crops in Andhra Pradesh (AP) state in southern India. Symptomatic plants were collected from the Amadalavalasa region of AP and the disease was maintained in kenaf under controlled conditions by whitefly transmission.


Figure 1:  Symptoms of leaf curl disease of kenaf

Total DNA was isolated from ten symptomatic leaf samples and was subjected to PCR amplification using an abuting primer pair (Forward 5’ – CAGAAGCCCTGATGTTCCAAG - 3’ and Reverse 5’ – TACATCCTGTACAGTCTGGGC - 3’) designed to the coat protein gene sequence of the begomovirus associated with the LCD of kenaf in northern India (EU366903). Amplifications yielded an ~2.7 kb amplicon. No DNA B component could be detected using primers described by Rojas et al. (1993) whereas reactions with universal betasatellite primers (Briddon et al., 2002) yielded an ~1.3 kb amplicon from all ten samples tested. The begomovirus and betasatellite PCR products from three kenaf samples were cloned and sequenced in their entirety in both orientations. The three clones of each showed high sequence identity (average 99.8% and 99.6% with respect to begomovirus and betasatellite respectively). One sequence each of the begomovirus (2761 nucleotides) and betasatellite (1361 nucleotides) have been deposited with GenBank (Accession Nos. EU431116 and EU431115, respectively).

The begomovirus and betasatellite showed the highest levels of sequence identity (95% and 92% respectively) with Tomato leaf curl Joydebpur virus (ToLCJV,  AJ875159) and its associated betasatellite (ToLCJB, AJ966244) reported from Bangladesh (Maruthi et al., 2006). Based on the ICTV species demarcation threshold for begomoviruses (89%), the virus obtained from kenaf is an isolate of ToLCJV. This is the first report of  ToLCJV and its betasatellite (ToLCJB) associated with a disease of a malvaceous crop.

Acknowledgement

The authors are grateful to the Director of CRIJAF for his keen interest during the present investigation. The first two authors are also grateful to the Indian Council of Agricultural Research for providing financial assistance during the tenure of which this work was carried out. 


References

Briddon RW, Bull SE, Mansoor S, Amin I, Markham PG, 2002. Universal primers for the PCR-mediated amplification of DNA β: a molecule associated with monopartite begomoviruses. Molecular Biotechnology 20, 315-318.

Maruthi MN, Rekha AR, Alam SN, Kader KA, Cork A, Colvin J, 2006. A novel begomovirus with distinct genomic and phenotypic features infects tomato in Bangladesh. Plant Pathology 55, 290.

Paul S, Ghosh R, Roy A, Mir JI, Ghosh SK, 2006. Occurrence of a DNA β-containing begomovirus associated with leaf curl disease of kenaf (Hibiscus cannabinus L.) in India. Australasian Plant Disease Notes 1, 29–30. 

Rojas MR, Gilbertson RL, Russell DR, Maxwell DP (1993) Use of degenerate primers in the polymerase chain reaction to detect whitefly-transmitted geminiviruses. Plant Disease 77, 340–347. 

The British Society for Plant Pathology