Reports Search NDR About NDR Editors Author Info Submission Links

Malvastrum coromandelianum is an alternative host of Tomato yellow leaf curl China virus

P. Liu, Y. Xie and X.P. Zhou*  

State Key Laboratory of Rice Biology, Institute of Biotechnology , Zhejiang University , Hangzhou 310029, P.R. China  

*zzhou@zju.edu.cn

Accepted for publication 17/6/08

Tomato yellow leaf curl China virus (TYLCCNV) is a distinct begomovirus first identified in tomato in Guangxi province of China. TYLCCNV causes yellow leaf curl disease of tomato and leaf curl disease of tobacco in southern China (Cui et al., 2004). To identify possible alternative hosts of this virus, a survey of weed samples with typical leaf-curling, vein-thickening or yellow-mosaic symptoms was conducted in tomato-growing areas of Yunnan province of China.  

Isolates Y277, Y278 and Y281 were obtained from Malvastrum coromandelianum plants showing yellow vein symptoms in Baoshan, Yunnan. Using primer pair TYLCCNV/F (taaagtggtccccgcagacacgtg) and TYLCCNV/R (TCAGGGCTTCTGTACATCC), designed to amplify part of the intergenic region and V2 gene of TYLCCNV, a 0.5 kb DNA fragment was PCR-amplified from total DNA extracts. The PCR product from Y278 was cloned and sequenced. Alignment of the sequence showed it to be identical to TYLCCNV-[Y264] (GenBank Accession No. AM261326). Using the sequences obtained, overlapping primers Y278F (ctcaaagcttaattatgacatggtc) and Y278R (agcggcctagattggacacac) were designed to amplify the full-length genome of TYLCCNV from isolate Y278. The complete genome sequence was determined to be 2741 nucleotides (AM980509), sharing 100% nucleotide sequence identity with TYLCCNV-[Y264].

Primer pair BetaF (GGGCTTCTTCCATCATGATTATGTC) and BetaR (GCCCCAGTAGAAGATATAGATGTAG), specific for TYLCCNV DNA β, was designed to amplify the putative DNA β associated with the virus. An amplicon of approximately 1.3 kb was obtained from the three isolates. Sequence analysis revealed that DNA βs of Y277 and Y281 were 1334 and 1335 nucleotides (AM980510 and AM980512), respectively, and were most closely related to the DNA β associated with TYLCCNV-[Y10] (AJ421621), with 97.0% and 99.7% nucleotide sequence identity, respectively. The DNA β of Y278 was 1342 nucleotides (AM980511), sharing the highest sequence identity (99.3%) with the DNA β associated with TYLLCCNV-[Y264] (AM260722).

M. coromandelianum plants with yellow-vein symptoms have previously been reported to be infected by Malvastrum yellow vein virus (MaYVV) and Malvastrum yellow vein Yunnan virus (MaYVYV) (Zhou et al., 2003; Jiang et al., 2005). Isolates Y277, Y278 and Y281 were shown to be co-infected with MaYVYV (results not shown). Whether TYLCCNV contributes to symptoms in M. coromandelianum will need to be investigated. Thus, at least in the presence of MaYVYV, M. coromandelianum is an alternative host of TYLCCNV and may contribute to the epidemiology of tomato yellow leaf curl or tobacco leaf curl diseases.  


References

Cui XF, Tao XR, Xie Y, Fauquet CM, Zhou XP, 2004. A DNAb associated with Tomato yellow leaf curl China virus is required for symptom induction. Journal of Virology 78, 13966-74.

Jiang T, Zhou XP, 2005. Molecular characterization of a distinct begomovirus species and its associated satellite DNA isolated from Malvastrum coromandelianum in China. Virus Genes 31, 43-8.

Zhou XP, Xie Y, Peng Y, Zhang ZK, 2003. Malvastrum yellow vein virus, a new Begomovirus species associated with satellite DNA molecule. Chinese Science Bulletin 48, 2205–9.

The British Society for Plant Pathology