1.10.7
MATING TYPE GENES CARRIED BY AN ASEXUAL ASCOMYCETE, FUSARIUM OXYSPORUM

T YOSHIDA2, T ARIE1, OC YODER3, BG TURGEON3 and I YAMAGUCHI1

1Institute of Physical and Chemical Research (RIKEN), Wako, Saitama 351-0198, Japan; 2Tohoku National Agricultural Experiment Station, MAFF, Arai, Fukushima 960-2156, Japan; 3Cornell University, Ithaca, NY 14853, USA

Background and objectives
Recently, mating type genes have been cloned and characterized in sexual ascomycetes such as Cochliobolus heterostrophus, Pyrenophora tritici-repentis and Nectria haematococca. Comparison of the sequences suggested that the products of these mating type genes are the master regulators of sexual development. However, mating type genes have not been reported in asexual fungi except Bipolaris sacchari [1]. As the initial step for getting an answer to the interesting question 'Why are asexual species asexual?', obtaining the DNA sequence information of mating type genes carried by them is important. For that purpose, the PCR-based strategy proposed for cloning MAT genes [2] was applied.

Materials and methods
Pathogenic strains of F. oxysporum f. sp. lycopersici, radicis-lycopersici, conglutinans and other formae speciales were used, along with some other non-pathogenic strains. For PCR amplification of the HMG-box which may exist on the mating type gene, degenerate primers FHMG11 (5' TACCGYAAGGAGCGTCACC) and FHMG12 (5' TTYWYCTSATCSGCSMKHWSCTTG), designed based on the HMG-box sequence of G. fujikuroi (anamorph F. moniliforme; GenBank AB005041) were used with genomic DNA of F. oxysporum. The single mating type locus consists of idiomorphs (non-homologous sequences) and is flanked by sequences common to both mating types in the case of known ascomycetes. To get the complete idiomorph containing HMG-box and its flanking regions, inverse- PCR and TAIL-PCR were performed with the genomic DNA as template. Sequences of flanking regions could be distinguished from the idiomorph by gel blot analysis. Using primers designed on the flanking sequences, the opposite mating type idiomorph was amplified by LA-PCR.

Results and conclusions
Cloning and sequencing of the 0.19-kb fragment obtained by PCR amplification with primers FHMG11 and FHMG12 revealed that the fragment contains the conserved HMG-box sequence in the 5' to 3' direction. Among 37 strains of F. oxysporum, nine strains, for example, f. sp. radicis-lycopersici SUF959 and f. sp. apii SUF1017, were determined to be carrying HMG-box. Following inverse-PCR and TAIL-PCR, a 7.0-kb fragment containing a complete idiomorph along with the both flanking regions was obtained. On the 5' and 3' flanks, primers Fo25 (5' AATAGCGAACAAGGATCAGGG) and Fo14 (5' ATATGGAGCAGTGATTGGAC) were designed to amplify the idiomorphs by LA-PCR. From the genomic DNA of the strains without HMG-box, a 5.2-kb fragment was amplified. This 5.2-kb fragment contained the conserved alpha-box sequence along the 3' to 5' direction. Primers Falpha1 (5' CGGTCAYGAGTATCTTCCTG) and Falpha2 (5' GATGTAGATGGAGGGTTCAA) were designed to amplify the 0.38-kb fragment containing alpha-box, and these primers did not amplify anything from the strains having HMG-box. Finally, we obtained 3.8 kb containing HMG-box and 4.6 kb containing alpha-box idiomorphs designated as MAT-2 and MAT-1, respectively, following the proposed MAT designation [2]. The primer combinations of FHMG11+ FHMG12 and Falpha1+ Falpha2 have therefore proved useful to determine the mating types of the F. oxysporum strains.

References
1. Sharon A, Yamaguchi K, Christiansen SK et al., 1996. Molecular and General Genetics 251, 60-68.
2. Arie T, Christiansen SK, Yoder OC, Turgeon BG, 1997. Fungal Genetics and Biology 21, 118-130.