1.2.4
A P53-LIKE PROTEIN ACCUMULATES IN PEA TISSUE INDUCED TO EXPRESS PR GENES

L HADWIGER, S KLOSTERMAN and J CHOI

Department of Plant Pathology, Washington State University, Pullman, WA 99164, USA

Background and objectives
The rapid activation of pathogenesis-related (PR) genes has been proposed to be the basis of both race-specific and non-host resistance in plants. We have utilized the pea/Fusarium solani system to investigate the mode of induction of PR genes in compatible (f. pisi) and incompatible (f. phaseoli) interactions. Genes and/or promoters for pea PR genes, beta-glucanase, chitinase, DRR49, DRR30 and DRR206 have been cloned and sequenced. Promoters from DRR49 and DRR206 were linked to the GUS reporter gene and transferred to tobacco. Transformed tobacco lines and/or untransformed pea tissue were treated with biotic elicitors and some DNA-altering agents such as actinomycin D, mitomycin C, camptothecin, psoralen and UV260 light. Since DNA alteration is a point of initiation of PR gene induction in peas, and for the accumulation of p53-protein and its pleiotrophic action on many other regulatory components in animal systems, a search for a p53-like mediator in plants was undertaken.

Materials and methods
Both p53 antisera, Pab 240 and the cDNA clone (HP119, Calbiochem), were specific for p53 in human tissue. The DNA sequence GGACATGCCCGGGCATGTCC which tightly binds p53 protein was synthesized by Operon Technologies.

Results and conclusions
We have previously reported that DNA damage occurs in pea endocarp tissue within 2.5 h following the application of Fusarium solani f. sp. phaseoli (Fsph) spores, or of the elicitors chitosan or Fsph DNase [1, 2]. Both of these biotic elicitors have been shown to induce immunity in pea tissue against the true pea pathogen, F. solani f. sp. pisi. These elicitors and other DNA-altering/damaging agents activate the expression of PR genes (DRR genes) or PR gene promoters in pea and/or tobacco tissue. p53-like protein and p53 homologous mRNA are detectable in pea with human anti-p53 antisera and a human p53 gene probe, respectively, following the application of these agents. Southern analysis detected p53-homologous DNA from the pea and tobacco genomes. A DNA sequence, GGACATGCCCGGGCATGTCC, known to bind authentic p53 transcription factor and retard the gel mobility of the complex, is also retarded in gel mobility in the presence of pea nuclear proteins. These observations suggest that a p53-like protein similar to the DNA damage-induced p53 of animal tissue may also occur in plants during a defence response. However, the pea p53-like protein detected on Westerns is twice the size of the animal protein.

References
1. Hadwiger LA, Chang M-M, Parsons MA, 1995. Molecular Plant-Microbe Interactions 8, 871-879.
2. Klosterman S, Hadwiger LA, Chang M-M et al., 1998. Proceedings of the 7th International Congress on Chitin and Chitosan (in press).