3.3.4
NESTED, MULTIPLEX PCR FOR DETECTION OF BOTH CLAVIBACTER XYLI SUBSP. XYLI AND XANTHOMONAS ALBILINEANS IN SUGARCANE

MJ DAVIS 1, P ROTT2 and G ASTUA-MONGE3

1University of Florida, Tropical Research and Education Center, 18905 SW 280 Street, Homestead, FL 33031, USA; 2Centre de Coopération Internationale en Recherche Agronomique pour le Développement, CIRAD-CA, BP 5035, 34032 Montpellier Cedex 1, France; 3University of Florida, Department of Plant Pathology, Gainesville, FL 32611, USA

Background and objectives
Ratoon stunting disease, caused by Clavibacter xyli subsp. xyli, and leaf scald disease, caused by Xanthomonas albilineans, are major bacterial diseases of sugarcane. They are often difficult to detect due to latency or the lack of diagnostic symptoms. To help overcome this problem and reduce diagnostic costs at the same time, we have developed a highly sensitive and specific PCR procedure for the simultaneous detection of both pathogens in sugarcane extracts.

Materials and methods
Milled juice or fibrovascular sap extracts were used as samples. Each sample was centrifuged at 500 g for 10 min. A 0.5-ml portion of the supernatant was diluted with 1.0 ml sterile water, vortexed, and centrifuged at 2940 g for 15 min. The pellet was resuspended in 1.0 ml TAE (0.04 M Tris-acetate; 1.0 mM EDTA pH 8.0) and centrifuged again at 2940 g for 15 min. After discarding the supernatant, the pellet was covered with 0.5 ml TAE amended with 0.4% Carnation non-fat dry milk, incubated at 100°C for 10 min, in a dry ice/alcohol bath for 3 min, at 100°C for 3 min, in a dry ice/alcohol bath for 3 min, and stored at -80°C. For PCR, the preparation was thawed and centrifuged at 16,000 g for 5 min, and 10 µl of the supernatant was used in a 25 µl reaction mixture (Promega buffer, 2.0 mM MgCl2, 0.1 mM of each dNTP, 10 pM of each primer and 1.5 U Taq DNA polymerase). The reaction mix for primary amplifications was supplemented with 0.4 µg/µl BSA fraction V. Nested reactions were conducted using a 1:40 dilution of the primary reaction products. Primary primers were RSD33 (CTGGCACCCTGTGTTGTTTTC) and RSD297 (TTCGGTTCTCATCTCAGCGTC) for C. xyli subsp. xyli, and XaAlb2-f3 (CACACACACAATACAGCATTGCGG) and XaAlb2-r3 (CCCAACTTACTTGAGGCTATGG) for X. albilineans. Secondary, nested primers were RST60 (TCAACGCAGAGATTGTCCAG) and RST59 (CGTCTTGAAGACACAGCGATGAG) for C. xyli subsp. xyli, and XaAlb2-f4 (CTTCTGCAGCTTGCTCGTC) and XaAlb2-r4 (GCTCAGTTACGCTCAGCTAATC) for X. albilineans. The thermocyler parameters were denaturization at 94°C for 4 min; 31 cycles of 94°C for 30 s, 55°C for 30 s, and 65°C for 1 min; and final extension of 65°C for 3 min. The PCR products were subject to electrophoresis in 1.0% agarose gel in TAE buffer and viewed with a UV transilluminator.

Results and conclusions
Cloned DNAs from the region between the 16S and 23S rRNA genes of C. xyli subsp. xyli [1] and from the albicidin gene complex of X. albilineans [2] were sequenced, and the sequences used to design PCR primers. When purified total DNA of each pathogen was tested, a minimum of 25 pg or less of DNA was detected with the primer pairs. The primary, multiplex reaction consistently amplified a 265-bp DNA fragment for C. xyli subsp. xyli and a 440-bp DNA fragment for X. albilineans. No amplification products were obtained with DNAs of other clavibacter and xanthomonad species tested. Attempts to detect the pathogens in crude mill juice were initially not successful due to inhibitors in the extracts. Differential centrifugation reduced inhibition, but additions of non-fat dry milk to the extraction buffer and BSA to the PCR reaction mix were often necessary to obtain amplification of the diagnostic DNA fragments. With some samples, a secondary multiplex amplification using the nested primer pairs was needed to detect the presence of the pathogens. The nested, multiplex reaction amplified a 229-bp DNA fragment for C. xyli subsp. xyli and a 308-bp DNA fragment for X. albilineans.

References
1. Astua-Monge G, Stall RE, Davis MJ, 1996. American Society of Sugar Cane Technologists 16, 128-129.
2. Rott P, Costet L, Davis MJ et al., 1996. Journal of Bacteriology 178, 4590-4596.