Molecular Plant Pathology On-Line [http://www.bspp.org.uk/mppol/] 1997/0123ueda

The rice dwarf phytoreovirus structural protein P7 possesses non-specific nucleic acids binding activity in vitro

S Ueda, I Uyeda.

Laboratory of Plant Virology and Mycology, Department of Agrobiology and Bioresources, Faculty of Agriculture, Hokkaido University, Sapporo 060, Japan

Corresponding Author:

I Uyeda, Laboratory of Plant Virology and Mycology, Department of Agrobiology and Bioresources, Faculty of Agriculture, Hokkaido University, Sapporo 060, Japan

email: Uyeda@res.agr.hokudai.ac.jp

Accepted: 23 January 1997

Abstract:

Interactions between structural proteins and genomic dsRNAs of purified rice dwarf phytoreovirus (RDV) were analysed by centrifugations in CsCl and cesium trifluoroacetate (CsTFA). In the presence of a high concentration of MgCl2, most of P8 was dissociated from the purified particles and core particles were obtained by ultracentrifugation in histidine-MgCl2 solution. By CsTFA density gradient centrifugation, core particles were separated into open core particles, protein-free genomic dsRNAs, and P7-dsRNA complexes (P7-dsRNA) according to densities. Open core particles were free from genomic dsRNAs. Transcriptional activities in vitro were not detected in open core particles and P7-dsRNA, although open core particles retained about 12% of the activity of purified virus. P7 was tested for nucleic acids binding activity by a Northwestern blotting assay using various nucleic acid probes. Intact P7 possessed activity that binds not only the RDV dsRNA or ssRNA but also rice ragged stunt virus dsRNA and ssRNA, and lambda DNA fragments. Although CsTFA centrifugation released P7 from the core particles, open core particles still retained some P7. Under the electron microscope, open core particles retained the spike-like structure. Antiserum to P7 failed to react with the surface structure of the open core particles suggesting that it is located inside the particles.

  • Introduction
  • Materials and Methods
  • Results
  • Discussion
  • References
  • INTRODUCTION

    Rice dwarf phytoreovirus (RDV) has 12 segmented dsRNAs as a genome and one copy of each segment is presumed to be packaged into a virion (Anzola et al., 1987). Purified viral particles transcribe full lengths of the 12 genomic segments by virion-associated RNA polymerase (Uyeda and Shikata, 1984).

    All the structural and non-structural proteins have been identified and assigned to the genomic segments (Suzuki et al., 1994; Murao et al., 1994). The virion consists of six polypeptides. P8 is a major outer capsid protein (Omura et al., 1989). P2 is a minor component of the outer capsid and plays a role in virus attachment and/or penetration into insect host cells (Nakata et al., 1978; Yan et al., 1996). P1, P3, P5 and P7 are components of the core capsid protein (Omura, 1995). P3 is a major core protein. P1, a minor component, is an RNA-dependent RNA polymerase (RDRP) because it has the GDD motif typical of RDRP (Suzuki et al., 1992). P5 is possibly a guanyltransferase since it shows GTP binding activity (Suzuki et al., 1996). P7 is the second major core component whose function is not yet known. Nothing is known about the replication and packaging of the genome into viral particles. Little has been shown about the precise roles of the non-structural proteins.

    Further analysis of structural proteins involved in transcription of genomic dsRNAs should give us some insight into morphogenesis of the virus. We are interested in the minimum requirements of structural components for virion-associated RNA polymerase activity. In this work, protein-protein and protein-RNA interactions of purified viral particles were examined by centrifugation in CsCl and cesium trifluoroacetate (CsTFA) or by Northwestern blotting assay. Here, we show not only interactions among P1, P3, P8, and P7 and genomic dsRNA but also that P7 possesses non-specific nucleic acid binding activity.

    MATERIALS AND METHODS

    Purification of virus and analyses of core particles

    Purified RDV (Uyeda and Shikata, 1982) was stored at -80oC in 0.1 M phosphate buffer (PB, pH 6.0) containing 50% glycerol. Core particles were isolated by the method of Takahashi et al. (1994) from the purified virus particles. Purified virus particles were incubated in 0.25 M histidine-1 mM DTT containing various concentrations of MgCl2 (His-MgCl) to dissociate the outer capsid protein P8 that was removed by ultracentrifugation. Under our conditions, 1 M MgCl2 removed P8 the most effectively and was used routinely. Isolated core particles were subjected to 3.13 M CsCl density gradient ultracentrifugation in His-MgCl at 32,000 rpm in a Beckman SW60Ti rotor for 24 hr at 6oC. Fractions were collected from the bottom of the gradient and used for protein and RNA analyses. Proteins were analysed by 7.5% SDS-PAGE (Laemmli, 1970) after trichloroacetic acid (TCA) precipitation and stained with a silver staining kit (Wako Co.). RNA was extracted with phenol-chloroform, precipitated with ethanol and analysed by 1% agarose electrophoresis. The gel was stained with 0.5ug/ml ethidium bromide and visualised under UV light.

    For electron microscopy, fractions containing the core particles were dialysed against 10 mM PB (pH 6.0) containing 1 mM DTT and then concentrated by ultracentrifugation. Pelleted particles were negatively stained with 2% phosphotungstic acid (PTA), pH 6.0 and examined under a JEM-1200EX electron microscope.

    Isolation of open core particles

    Isolated core particles were subjected to 2.35 M or 3.57 M CsTFA density gradient centrifugation in 1 mM DTT at 38,000 rpm in a Beckman SW60Ti rotor for 24 hr at 6oC. Fractions were collected and analysed as described above. Densities were determined by measuring the refractive index and using a formula described by (Andersson and Hjorth (1985).

    Assay of in vitro transcriptase activity

    The reaction mixture (50 ul) contained 0.1 M Tris-HCl (pH 8.5), 5 mM MgCl2, 5 mM phosphoenol pyruvate, 2.5 U pyruvate kinase, 1 mM S-adenosyl-L-methionine, 25ug bentonite, 1 mM DTT, 1.5 mM each ATP, CTP, GTP, 0.01 mM UTP, 5 uCi 3H-UTP (specific activity 3Ci/umol), and core particles or open core particles (Uyeda and Shikata, 1984). Amounts of the particles were adjusted so that they were equivalent to 1ug purified virus. Incubation was at 36oC for 2 hours and aliquots were immediately collected on a glass filter GC50 (Toyo Co.), washed, and incorporation of 3H was counted.

    Expression of P7 in bacteria

    A full-length cDNA to RDV S7 was cloned in pUC119 (Lee, unpublished). A construction was made so that the EcoR I site of the polylinker region remained intact downstream of the 3' terminus of the cDNA. A cDNA fragment from the initiation codon to the 3' terminus was amplified by polymerase chain reaction (PCR) using two primers: 5' CCCGAATTCATGTCTGCGATTGTA 3' and universal M4 primer of the vector plasmid. The product was digested with EcoR I and inserted into the EcoR I site of pMAL-c2. E.coli DH5alpha strain was transformed with the resulting plasmid pMALRDANS7; P7 was expressed as described (Ausubel et al., 1987), and purified by affinity chromatography according to the manufacturer's protocol.

    Western blotting

    Viral proteins were separated by 7.5% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and blotted onto Immobilon-P membrane (Millipore Co.). Proteins were probed with antiserum to P7. Antiserum to P7 was made by injecting affinity-purified MBP fusion protein into a rabbit.

    Preparation of probes

    RDV genomic dsRNAs were extracted from purified virus (Murao et al., 1994). RDV S10 ssRNAs were synthesised in vitro from pUMRD10 (Matsumura et al., 1990). S10-defective ssRNAs were synthesised as above from pUMRD10NH. pUMRD10NH was constructed by deleting a fragment between a Nsp V site (196 nt from the 5' terminus) and a Hinc II site (164 nt from the 3' terminus). Rice ragged stunt virus (RRSV) S9 dsRNAs and ssRNAs were synthesised as described (Suga et al., 1995). The dsDNAs were prepared by digesting lambda DNA with Sty I. The terminal labelling methods using [ gamma-32P]ATP were as described by Sambrook et al. (1989).

    Northwestern blotting

    The Northwestern blotting assay was performed according to Mattion et al. (1992). Standard binding buffer (SBB) was modified as follows: 10 mM Tris-HCl, pH 7.0, 1 mM EDTA, 50 mM NaCl, 1 mM DTT, 0.08 % bovine serum albumin, 0.04 % Ficoll, 0.04 % polyvinylpyrrolidone containing 50ug/ml salmon sperm DNA. After electrophoresis, proteins were transferred to Hybond-C pure membrane (Amersham Co.). The membranes were hybridised in SBB (pH 8.3) containing 2.0 x 105 cpm/ml labelled nucleic acids after soaking overnight in SBB (pH 7.0). For the competition assay, 10ug/ml non-labelled RDV genomic dsRNAs were added. After washing and drying, membranes were exposed to an imaging plate for 2 days and analysed on a Bio-Imaging Analyzer Bas 1000 (Fujix Co.).

    RESULTS

    Particle composition of core particles

    Purified virus particles were composed of P1, P3, P7 and P8 as revealed by SDS-PAGE (Figure 1). P2 was removed and not detected because the virion was treated with chloroform during purification as pointed out previously by Nakata et al. (1978). P5 was not also detected because it exists at a low level in vivo (Suzuki et al., 1994).

    Purified virus was incubated in His-MgCl solution and then core particles were collected by ultracentrifugation or CsCl density gradient centrifugation in His-MgCl solution. Analyses by SDS-PAGE showed that the majority of P8 was removed from the virus particles as reported by Takahashi et al. (1994) but not completely. A considerable number of P1 molecules were also removed from the virus particles (Figure 1). The core particles prepared in this way were composed of genomic dsRNA and proteins P3, P7, and a small amount of P1 (Figure 2).

    Dissociation of core particles into open core and genomic RNA

    The open core particles devoid of genomic dsRNAs were isolated by centrifugation through CsTFA. They banded at densities of 1.31 - 1.34ug/ml and were composed of P3, P1 and P7 (Figure 3A, fraction 9-11). Genomic dsRNAs were not detected. Major components at the higher density range are P7 and genomic dsRNAs. Most of the genomic dsRNAs were banded at densities of 1.73 - 1.78 g/ml (Figure 3B, fraction 2-4), and the fraction did not contain a detectable level of proteins.

    Between the two major fractions of the open core and genomic RNAs, variable amounts of P7 and traces of genomic dsRNAs were detected (Figure 3B), suggesting that P7 is complexed with genomic RNAs. Since CsTFA solution dissociates protein-RNA interactions, we suspected that the complex is tightly bound and P7 may be an RNA binding protein.

    Transcriptional activity of core and open core particles

    RNA polymerase activity of separated core particles, open core particles and P7-dsRNA complexes were compared with respect to purified virus. About 12 % of the activity was retained in the core particle preparations while both open core particles and P7-dsRNA complexes retained no activity (Figure 4).

    Electronmicroscopy

    Core particle preparations contained mostly a single shell structure with a spike-like structure (Figure 5B). There were also particles whose outer capsids were partially stripped. Open core particle preparations contained spherical particles about the same diameter as the core particles. The stain penetrated into particles with an empty appearance. A spike-like structure was retained in open core particles (Figure 5C). In order to determine whether the spike-like structure is composed of P7, a decoration technique was performed. The antiserum to P7 did not decorate the surface structure of either core or open core particles, suggesting that P7 is located inside the particles.

    RNA binding activity of P7

    Because the suspected P7-dsRNA complex was detected in CsTFA density gradient centrifugation, RNA binding activity of P7 was tested. When RDV genomic dsRNAs were used as a probe, a strong signal was detected only at the position of P7 in a Northwestern blotting assay (Figure 6). Non-labelled RDV genomic dsRNAs effectively competed with labelled ones (data not shown). The binding activity was not specific to the viral genomic RNAs, since other nucleic acid probes also bound to P7 as shown in Figure 7.

    P7 fused to MBP, however, did not show RNA binding activity to any of nucleic acid probes tested (data not shown).

    DISCUSSION

    Not only most of P8 but also P1 were dissociated from the core particles during the centrifugation in His-MgCl solution. Decrease in transcriptional activity of core particles was similar to that of the particles reported by Nakata et al. (1978). The decrease in the activity is probably due to reduction of P1 molecules and is consistent with the proposed function of P1 as a core RNA polymerase predicted from the amino acid sequence (Suzuki et al., 1992).

    This study demonstrated that P7 binds tightly to genomic dsRNAs. CsTFA is highly capable of denaturing proteins to facilitate isolation of nucleic acids during centrifugation (Zarlenga and Gamble, 1987), and it is therefore used in density gradient centrifugation to dissociate viral RNAs from proteins. For example, influenza virus ribonucleoprotein (RNP) cores were completely dissociated into protein-free RNA and RNA-free protein fractions (Honda et al., 1988). The P7-dsRNA complex remained bound during the centrifugation, indicating that P7 might be a nucleic acid binding protein. On the other hand, open core particles which were composed of P1, P3 and a reduced amount of P7, but devoid of genomic dsRNAs, remained as spherical particles. The open core particle keeps its integrity by protein-protein interaction and P7 may play a key role in packaging.

    Northwestern blotting analyses showed P7 binds not only to genomic dsRNAs, but also to single-stranded RNA, dsRNAs of other viruses, and dsDNAs. Whether specificity of P7 to viral genomic RNAs is destroyed during electrophoresis in the presence of SDS or whether other factors are operating in vivo for its specificity is unknown. The non-specific nature of the binding activity remains to be explained. Homology searches of functional domains of P7 using the computer program MACAW to other Reoviridae proteins known to have RNA binding activity failed to detect any conserved sequences. They are lambda1 (Bartlett and Joklik, 1988), delta2 (Schiff et al., 1988), delta3 (Huismans and Joklik, 1976), deltaNS (Stamatos and Gomatos, 1982), and uNS (Antczak and Joklik, 1992) for reoviruses, and deltaNS53 (Hua et al., 1994), NS35 (Kattoura et al., 1992), and NS34 (Mattion et al., 1992) for rotaviruses.

    The fact that antiserum to P7 did not react with the surface structure of core particles and that open core particles retained a large amount of P7 after CsTFA centrifugation indicate P7 is localised inside the particles. Since open core particles consist of major core components of P3, P1 and P7, P1 is a strong candidate for one of the spike-like structural components because a large amount of P1 was dissociated easily from the core particles through centrifugations in His-MgCl solution. Taken together with the fact that P1 is a core RNA polymerase, P7 may have a function for P1 to interact with genomic dsRNAs. It remains to be analysed how P7 interacts inside the core particles, and to which components of open core particles.

    REFERENCES

    Andersson K, Hjorth R, 1985. Isolation of bacterial plasmids by density gradient centrifugation in cesium trifluoroacetate (CsTFA) without the use of ethidium bromide. Plasmid 13, 78-80.

    Antczak JB, Joklik WK, 1992. Reovirus genome segment assortment into progeny genomes studied by the use of monoclonal antibodies directed against reovirus proteins. Virology 187, 760-76.

    Anzola JV, Xu Z, Asamizu T, Nuss D, 1987. Segment-specific inverted repeats found adjacent to conserved terminal sequences in wound tumor virus genome and defective interfering RNAs. Proceedings of the National Academy of Sciences, USA 84, 8301-05.

    Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K, 1987. Current Protocols in Molecular Biology. Green Publishing Associates and Wiley-Interscience 16.6.1-14.

    Bartlett JA, Joklik WK, 1988. The sequence of the reovirus serotype 3 S3 genome segment which encodes the major core protein delta1. Virology 167, 31-37.

    Honda A, Ueda K, Nagata K, Ishihama A, 1988. RNA polymerase of influenza virus: role of NP in RNA chain elongation. Journal of Biochemistry 104, 1021-26.

    Hua J, Chen X, Patton JT, 1994. Detection mapping of the rotavirus metalloprotein NS53(NSP1): the conserved cysteine-rich region is essential for virus-specific RNA binding. Journal of Virology 68, 3990-4000.

    Huismans H, Joklik WK, 1976. Reovirus-coded polypeptides in infected cells: isolation of two native monomeric polypeptides with high affinity for single-stranded and double-stranded RNA, respectively. Virology 70, 411-24.

    Kano H, Koizumi M, Noda H, Mizuno H, Tsukihara T, Ishikawa K, Hibino H, Omura T, 1990. Nucleotide sequence of rice dwarf virus (RDV) genome segment S3 coding for 114K major core protein. Nucleic Acids Research 18, 6700.

    Kattoura MD, Clapp LL, Patton JT, 1992. The rotavirus nonstructural protein, NS35, possesses RNA-binding activity in vitro and in vivo .Virology 191, 698-708.

    Laemmli UK, 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 277, 680-85.

    Matsumura T, Uyeda I, Shikata E, 1990. Production of complete transcripts of rice dwarf virus genome segment 10 in vitro. Memories of the Faculty of Agriculture Hokkaido University 17, 107-12.

    Mattion NM, Cohen J, Aponte C, Estes M, 1992. Characterization of an oligomerization domain and RNA-binding properties on rotavirus nonstructural protein NS34. Virology 190, 68-83.

    Murao K, Suda N, Uyeda I, Isogai M, Suga H, Yamada N, Kimura I, Shukata E, 1994. Genomic heterogeneity of rice dwarf phytoreovirus field isolates and nucleotide sequences of variants of genome segment 12. Journal of General Virology 75, 1843-48.

    Nakata M, Fukunaga K, Suzuki N, 1978. Polypeptide components of rice dwarf virus. Annals of the Phytopathological Society of Japan 44, 288-96.

    Omura T, 1995. Genomes and primary protein structures of phytoreoviruses. Seminars in Virology 6, 97-102.

    Omura T, Ishikawa K, Hirano H, Ugaki M, Minobe Y, Tsuchizaki T, Kato, T, 1989. The outer capsid protein of rice dwarf virus is encoded by genome segment S8. Journal of General Virology 70, 2759-64.

    Sambrook J, Fritsch EF, Maniatis T, 1989. Molecular Cloning: Laboratory Manual 2nd edn New York, Cold Spring Harbor Laboratory chapter 10, pp 59-61.

    Schiff LA, Nibert ML, Co MS, Brown EG, Fields BN, 1988. Distinct binding sites for zinc and double-stranded RNA in the reovirus outer capsid protein s3. Molecular Cell Biology 8, 273-83.

    Stamatos NM, Gomatos PJ, 1982. Binding to selected regions of reovirus mRNAs by a nonstructural reovirus protein. Proceedings of the National Academy of Sciences, USA 79, 3457-61.

    Suga H, Uyeda I, Yan J, Murao K, Kimura I, Tiongco ER, Cabautan P, Koganezawa, H, 1995. Heterogeneity of rice ragged stunt oryzavirus genome segment 9 and its segregation by insect vector transmission. Archives of Virology 140, 1503-09.

    Suzuki N, Kusano T, Matsuura Y, Omura T, 1996. Novel NTP binding property of rice dwarf phytoreovirus minor core protein P5. Virology 219, 471-74.

    Suzuki N, Sugawara M, Kusano T, Mori H, Matsuura Y, 1994. Immunodetection of rice dwarf phytoreoviral proteins in both insect and plant hosts. Virology 202, 41-48.

    Suzuki N, Tanimura M, Watanabe Y, Kusano T, Kitagawa Y, Suda N, Kudo H, Uyeda I, Shikata E, 1992. Molecular analysis of rice dwarf phytoreovirus segment S1: Interviral homology of the putative RNA-dependent RNA polymerase between plant- and animal-infecting reoviruses. Virology 190, 240-47.

    Suzuki N, Watanabe Y, Kusano T, Kitagawa Y, 1990. Sequence analysis of rice dwarf phytoreovirus segment S3 transcript encoding for the major structural core protein of 114KDa. Virology 179, 455-59.

    Takahashi Y, Tomiyama M, Hibino H, Omura, T, 1994. Conserved primary structures in core capsid proteins and reassembly of core particles and outer capsids between rice gall dwarf and rice dwarf phytoreoviruses. Journal of General Virology 75, 269-75.

    Uyeda I, Shikata E, 1982. Ultrastructure of rice dwarf virus. Annals of the Phytopathological Society of Japan 48, 295-300.

    Uyeda I, Shikata E, 1984. Characterization of RNAs synthesized by the virion-associated transcriptase of rice dwarf virus in vitro. Virus Research 1, 527-32.

    Yan J, Tomaru M, Takahashi A, Kimura I, Hibino H, Omura T, 1996. P2 protein encoded by genome segment S2 of rice dwarf phytoreovirus is essential for virus infection. Virology 224, 539-41.

    Zarlenga DS, Gamble HR, 1987. Simultaneous isolation of preparative amount of RNA and DNA from Trichinella spiralis by cesium trifluoroacetate isopycnic centrifugation. Analytical Biochemistry 162, 569-74.