A.

CLCrV  ACAGGCCCATGTACAGGAAGCCCAGAATCTATCGCACGTTAAGAACGCCTGACATTCCGA
       |||||||||||||||||||||||||||| ||||| | ||  ||||  || ||  |||| |
CLCuV  ACAGGCCCATGTACAGGAAGCCCAGAATGTATCGGATGTACAGAAGTCCGGATGTTCCAA

CLCrV  GAGGCTGTGAAGGGCCATGTAAAGTCCAGTCATATGAACAGCGCCACGATGTCTCACACG
         || |||||||| |||||||| || || || | |||   | | || ||||||   ||
CLCuV  AGGGTTGTGAAGGCCCATGTAAGGTACAATCTTTTGAGTCGAGACATGATGTCGTTCATA

CLCrV  TGGGTAAGGTAATGTGTATATCTGATGTCACACGTGGTAATGGTATCTCCCTCCGTGTCG
       | ||||||||||||||||| |||||||| || ||||||   ||| |  |||  ||| | |
CLCuV  TTGGTAAGGTAATGTGTATTTCTGATGTTACTCGTGGTGTCGGTTTGACCCATCGTATTG

CLCrV  GTAAGCGTTTCTGTGTTAAGTCTGTATATATTTTAGGGAAAATATGGATGGATGAGAATA
       |||| ||||| ||||| ||||| || ||| ||||||| || |||||||||||||| ||||
CLCuV  GTAAACGTTTTTGTGTCAAGTCAGTTTATGTTTTAGGTAAGATATGGATGGATGAAAATA

CLCrV  TTAAGCTGAAGAACCACACGAATAGCGTCATTTTTTGGCTGGTTAGAGATCGTAGACCAT
       | |||   ||||| |||||||||   || || || |   | ||  | |||||  | ||
CLCuV  TAAAGACCAAGAATCACACGAATTCGGTGATGTTCTTTTTAGTCCGCGATCGACGTCCTG

CLCrV  ATGGCACTCCTATGGACTT
        || ||  |||  ||| ||
CLCuV  TTGACAAACCTCAGGATTT

B.

CLCrV  CCACCTTTAATTTGAACCGGTTTCCCGTACTTGCAATTTGACTGCCAGTCTTTTTGGGCC
       || |||||||||||||| || ||| |     |     |||  |  |       || |  |
CLCuV  CCTCCTTTAATTTGAACGGGCTTCGCCGTACTTTGTGTTGGATTGCCAGTCCCTTTGTGC

CLCrV  CCCAAGAAGCTCTTTCCAATGCTTTAGCTTTAGGTATTGCGGTGCTACGTCATCAATGAC
       ||| |  | ||||||  | |      | || ||| | |||||  | ||||||||||||||
CLCuV  CCCCATGAACTCTTTAAAGT------GTTTGAGGAAATGCGGGTCGACGTCATCAATGAC

CLCrV  GTTATAGGCAACATTATTCGAGTACACTCGATTATTGAAGTCCAGGTGTCCACTAAGGTA
        |||||     | |  ||   ||| ||      | | | |||||| |||||||  |  ||
CLCuV  ATTATACCAGGCGTCGTTACTGTAGACCTTGGGACTCAGGTCCAGATGTCCACACAAATA

CLCrV  ATTATGTGGGCCTAAAGCACGAGCCCACATCGTCTTGCCTGTTCTAGAATCACCTTCCAC
        |||||||| || || |  | ||||||||||||||| || || | |  ||| ||||| |
CLCuV  GTTATGTGGTCCCAATGACCTAGCCCACATCGTCTTCCCCGTACGACTATCTCCTTCAAT

CLCrV  TATGAGACTAACTGGTCTTA
        |  | |||    |||||
CLCuV  CACTATACTTTGAGGTCTGT

Figure 8. Alignment of the partial DNA sequences of the capsid protein gene region (A) and AC1 gene region (B) of cotton leaf crumple virus (CLCrV) and cotton leaf curl virus (CLCuV). Sequences were determined from cloned PCR DNA fragments of each virus. Sequences alignments were generated with the FASTA program (Pearson and Lipman, 1988) in the GCG software package. Identical nucleotides are indicated by vertical lines. Gaps were inserted to allow maximum alignment and denoted as dash.