Australia    AGCACGGGGGACTATTATTACCCCCC.GTGCTCGGGACGGGACATGACGTCAGCAAGGAT
Burundi      --------------------------.---------------------------------
Fiji         --------------------------.-----------------------------T-CA
W. Samoa     --------------------------C-----T-----C-----------------T-TA
Taiwan       --------------------------.-----------------------A----TA---
Vietnam      ---G-C-------------------G.-C-------------------A------TA---
             *** * *******************  * *** ***** ********* * ****  * 

Australia    TATAATGGGCTTTTTATTAGCCCATTTA.TTGAATTGGGCCGGGT.TTTGTCATTTTACA
Burundi      -------------------------G--.----------------.--------------
Fiji         G---------C-AA--A.----------.-A--------------.--------C-----
W. Samoa     G---------C-AA--A.----------.-A--------------.--------C-----
Taiwan       ----------------AAG.-----A--AAG---G----------T-GA-A---A--T-G
Vietnam      ----------CAAC--AAG---------A-A-------..----AA----A---A--T--
              *********    **    ***** **   *** ***  ****  *  * *** ** *

Australia    AAAGCCCGGTCCAGGATAAGTATAATGTCACGTGCCGAATTAAAAGGTTGCTTCGCCACG
Burundi      --------------------A-------------------.----------------T--
Fiji         -----------------T--A-------------------.--G-------------T--
W.Samoa      -----------------T--A-------------------.--G-------------T--
Taiwan       ---------.--T---A---G----A--------------.--T-------------G--
Vietnam      --T----A-.--T---AGT-G-------------------.--G-------------T--
             ** **** * ** ***   * **** ************** ** ************* **

Australia    AAGAAACCTAATTTGAGGTTGCGTATTCAATACGCTACCGAATATCTATTAATATGTGAG
Burundi      ------------------------------------------------------------
Fiji         ----------T--------A----------------------------------------
W. Samoa     ----------T--------A----------------------------------------
Taiwan       ---C--------AAATT------------------A---A--AG------------CCT-
Vietnam      ---C--T-CG-A-AA-T------------------A--T---.G------------GAT-
             *** ** *         ** *************** **  **  ************   *

Australia    TCTCTGCCGAAA.AAAATCAGAGCGAAAGCGGAAGGCAGAAGCGATGGATTGGGCGGAAT
Burundi      ------------.C--.-------------..--A-------------------------
Fiji         ------------T-----------------..G-A-------------------------
W. Samoa     ------------.----A------------..G-A-------------------------
Taiwan       -----------T..-----------T-T---.--A.-------------------A----
Vietnam      -----------T..-----------T-----.G-A--------------------A----
             ***********   **  ******* * **   *  ******************* ****

Australia    CACAATTCAAGACCTGTACTCATGGATGCGATTGGAAGAAGATATCATCGGATTCAGCCG
Burundi      -------------T----------------------------------------------
Fiji         ----------------------------------T-------------------------
W. Samoa     -------------------C----------------------------------------
Taiwan       -------------A-----C-----C--T----------C----------------T---
Vietnam      -------------------------G-------------C----------------T---
             ************* ***** ***** ** ***** **** **************** * *

Australia    ATAATCGACAATATGTACCATGCGTCGATTCTGGAGCTGGAAGAAAGTCGCCTCGCAAGG
Burundi      ------------------------------------------------------------
Fiji         ----------------G-------------------------------------------
W. Samoa     ----------------G--------------A-----------------------T----
Taiwan       -A-----G-----------T--------C-----TT-----------A------------
Vietnam      -G-----------------T--------CG----CAGC-----------A----------
             * ***** ******** ** ********  * **    ********* * ***** ****


Australia    TACTTCTTAGATCTATTGAAGCTGTGTTTAACGGAAGCTTCAGCGGAAATAATAGGAATG
Burundi       ----------------------------------------------------------C-
Fiji         ------------------------------------------------------------
W. Samoa     -------------------------------T--------------------------C-
Taiwan       --------C-------C--------A-----T-----T----AA--G------C------
Vietnam      ----G--A-----------------------T----------AA--------C-------
             **** **  ******* ******** ***** ***** ****  ** *****  **** *
Australia    TTCGTGGATTTCTCTACGTATCGATCAGAGACGATGACGGAGAAATGCGTCCAGTACTCA
Burundi      ------------------------------------------------------------
Fiji         ------------------------------------------------------------
W. Samoa     -------------------------------------------------------G----
Taiwan       -------C--CT-A--------A---C----------T---AC---------------T-
Vietnam      -------G---A-A--------A--AC----------T----------------------
             ******* **  * ******** **  ********** ***  ************ ** *

Australia    TAGTACCATTCGGAGGATATGGATATCATAATGATTTTTATTATTTCGAAGGGAAGGGGA
Burundi      -------------------------------------C--------------A-------
Fiji         ----------------T--------------------C----------------------
W. Samoa     ----------------T--------------------C--------------A-------
Taiwan       ----------T-----------------C-------------------------------
Vietnam      --A----------------------------------C-------------------- --
             ** ******* ***** *********** ******** ************** *******

Australia    AAGTTGAATGTGATATATCATCAGATTATGTTGCGCCAGGAATAGATTGGAGCAGAGACA
Burundi      ------------------------------------------------------------
Fiji         ------------------------------------------------------------
W. Samoa     ------------------------------------------------------------
Taiwan       ---------------------------------------A-G------------------
Vietnam      -------------------------------A---------G-C----------------
             ******************************* ******* * * ****************

Australia    TGGAAGTTAGTATTAGTAACAGCAACAACTGTAATGAATTATGTGATCTGAAGTGTTATG
Burundi      ------------------------------------------------------------
Fiji         ------------------------------------------------------------
W. Samoa     ------------------------------------------------------------
Taiwan       ---------------------------------------C--------------------
Vietnam      ------------------------------------------------------------
             *************************************** ********************

Australia    TTGTTTGTTCGTTAAGAATCAAGGAATAAAAGTTGTGCTGTAATGTTAATTAATAAAACG
Burundi      ----------T------------------------------------T------------
Fiji         -----------------------------------------------T------------
W. Samoa     -----------------------------------------------T------------
Taiwan       --A----------------A---------C--A---------T--AAT---------T-T
Vietnam      -------------------A---------C--A------------A-T-----------A
             ** ******* ******** ********* ** ********* **   ********* *

Australia    TATATTTGGGA.AATTGATAGTTGTATAAAACATACAACACACTATGAAATACAAGACGC
Burundi      -----------.-----------------------------G------------------
Fiji         -----------.------------------------------------------------
W. Samoa     -------T---T-----TAG----------------------------------------
Taiwan       ---T--AAATGA-----------------------------G------C-A-AGG-GAAA
Vietnam      ---T--CA.TGT-----------------------------G------C-A--GG-GAAA
             *** **      *****   ********************* ****** * *   *   


Australia    TATGACAAATGTACGGGTATCTGAATGAGTTTTAGTATCGCTTAAGGGCCGCAGGCCCGT
Burundi      ------------------------------------------------------------
Fiji         ------------------------------------------------------------
W. Samoa     ---------..-----------------------------A-------------------
Taiwan       A-.TGA---...-TAA-GGGT---T--TTC-A----------------------------
Vietnam      A-ATGA---...-TC--GGGT---T--GTC-A-C--------------------------
              *    ***   *   *    *** **   * * ****** *******************


Australia    T.AAAAATAATAATCGAATTATAAACGTTAGATAATAATCAGAGATAGGTGATCA.GATA
Burundi      -G-----------------------------------------------------.----
Fiji         -G-----------------------------------------------------.----
W. Samoa     -G---------------------T-----T------------------A------.----
Taiwan       -G---------------------T---A-T------------------A------A-GAT
Vietnam      -G----------------------------------------------A------.-CAT
             * ********************* *** * ****************** ****** *  

Australia    ATATAAACATAAACGAAGTATATGCCGGTACAATAATAAAATAAGTAATAACAAAA...A
Burundi      -C----------------------G-----------------------A--A----...-
Fiji         --------------------------------------------------------.AA-
W. Samoa     -----------------------------------------------T-T-A-C--TAA-
Taiwan       -----------G------------G-T---T-----A----G---C-TAT-AT-T-....
Vietnam      CC-A-------G-------.----G-T---T----TA---.G---C-TAT-A.-T-....
               * ******* ******* **** * *** ****  ***  *** *   *    *   

Australia    AAATATGTATACTAATCTCTGATTGGTTCAGGAGAAAGGCCCACCAACTAAAAGGTGGGG
Burundi      C-T----A-----------------------A---------------A------------
Fiji         -------------------------------A----------------------------
W. Samoa     -G-A-----A-----------------G---A------A---------------------
Taiwan       ---------------------------G---A-AGT--A-----T----TT---T-A-T-
Vietnam      --------GA-------------------G-A-CGT-C.----------TT-.-TG--T-
                 ***   ***************** * * *   *  ***** ** *  * *   * *

Australia    A..GAATGTCCCGATGACGTA
Burundi      -..------------------
Fiji         -..------------------
W. Samoa     -..------------------
Taiwan       G..A-----------------
Vietnam      GCCAG----------------
                  ****************

Figure 3. Alignment of BBTV DNA-6 sequences from Australia, Burundi, Fiji, Taiwan, Vietnam and Western Samoa. (*) indicates identity in all sequences. The Australian sequence is marked to indicate putative functional and structural regions. The CR-SL which includes the potential stem-loop is underlined. The potential TATA region is double-underlined. The ORF is in italics with the start and stop codons also in bold. Potential polyadenylation signals are in italics and underlined. The CR-M is in italics and double-underlined. Dashes indicate identity with the Australian sequence. Dots indicate gaps.