Table 1. BBTV component specific primer pairs used to amplify DNA components from various isolates of BBTV.

Primer Sequence (5' to 3') Component specificity Position1
BT80-F1 GCATCCAACGGCCCATA 2 1018-1002
BT80-R3 CCTAATCCTGTCAAGGA 2 266-282
BT3V1-EXP *TAGATCCATGGTCAGACAAGAAA 3 217-228
BT3C1-EXP *ATAAAGCTTTCAAACATGATATGT 3 740-726
BT4V3.17 ATGGCATTAACAACAGA 4 279-295
BT4C2.17 GAACATAGGTCCAGCGT 4 629-613
BT129V3.17 GTTATCATGGCATCGAC 5 639-655
BT129C1.17 GGACCCTACGTTGCCAG 5 993-977
BTP2F1.17 TATTAGTAACAGCAACA 6 667-683
BTP2R1.17 CTAACTTCCATGTCTCT 6 666-650

1: Position refers to the nucleotide number within each BBTV DNA component using the numbering system of Burns et al. (1995).

*: The 5' end sequences in bold were non-complimentary linker DNA arms.