Relationships amongst barley and oat infecting isolates of Pyrenophora spp. based on sequences of the internal transcribed spacer regions of ribosomal DNA Figure 3

1 70 Pgx78124 CACAAATATGAAG*GCAGATTGGGTAGTCCCC****GCTTTGGGGGGTTTGCC*********CATTCTGG Pg11 ---------------------------------------------------------------------- Pg15 ---------------------------------------------------------------------- Pg2376 ---------------------------------------------------------------------- Pg5 ---------------------------------------------------------------------- Pg6 ---------------------------------------------------------------------- Pg7 ---------------------------------------------------------------------- Pt15 -----------------------------------------T---------------------------- Pt16 -----------------------------------------T---------------------------- Pt17 -----------------------------------------T---------------------------- Pt18 -----------------------------------------T---------------------------- Pt29 -----------------------------------------T---------------------------- Pt4 -----------------------------------------T---------------------------- Pm2 -----------------------------------------T---------------------------- Pm4 -----------------------------------------T---------------------------- Pm857 -----------------------------------------T---------------------------- Pm1881 ****-------------------------------------T---------------------------- Pm1892 -----------------------------------------T---------------------------- Pm1893 --***********-***------------------------T---------------------------- Ph94-2 -----------------------------------------T---------------------------- Pa91-1b -----------------------------------------T---------------------------- Pa3828 -C----------AC-----C----C-CC-T-GAGGA--GA-TC-TC--CCC--TCCTGGGGC-GG----A X78123 -C----------AC-----C----C-CC-T-GAGGA--GA-TC-TC--CCC--TCCTGGGGC-GG----A 71 140 X78124 CGCCATATTCACCCATGTCTTTTGCGTACTACTTGTTTCCTTGGCGGGCTCGCCCGCCAATTGGACTTTA Pg11 ---------------------------------------------------------------------- Pg15 ---------------------------------------------------------------------- Pg2376 ---------------------------------------------------------------------- Pg5 ---------------------------------------------------------------------- Pg6 ---------------------------------------------------------------------- Pg7 ---------------------------------------------------------------------- Pt15 ---------------------------------------------------------------------- Pt16 ---------------------------------------------------------------------- Pt17 ---------------------------------------------------------------------- Pt18 ---------------------------------------------------------------------- Pt29 ---------------------------------------------------------------------- Pt4 ---------------------------------------------------------------------- Pm2 ---------------------------------------------------------------------- Pm4 ---------------------------------------------------------------------- Pm857 ---------------------------------------------------------------------- Pm1881 ---------------------------------------------------------------------- Pm1892 ---------------------------------------------------------------------- Pm1893 ---------------------------------------------------------------------- Ph94-2 ---------------------------------------------------------------------- Pa91-1b ---------------------------------------------------------------------- Pa3828 ------------------------------------------------T----------T-A----CCA- Pax78123 ------------------------------------------------T-------**-T-A----CCA- 141 195 Pgx78124 TTCAAACCTTTTTTT**ATTGCAATCAGCGTCAGCAAAACAATGTAATCAATTA Pg11 -----*--C------TT------------------------------------- Pg15 -----*--C------TT------------------------------------- Pg2376 ------------------------------------------------------ Pg5 -----*--C------TT------------------------------------- Pg6 ------------------------------------------------------ Pg7 ------------------------------------------------------ Pt15 ------------------------------------------------------ Pt16 ------------------------------------------------------ Pt17 ------------------------------------------------------ Pt18 ------------------------------------------------------ Pt29 ---------------TT------------------------------------- Pt4 ------------------------------------------------------ Pm2 ---------------TT------------------------------------- Pm4 ---------------TT------------------------------------- Pm857 ---------------TT------------------------------------- Pm1881 ---------------TT------------------------------------- Pm1892 ---------------TT------------------------------------- Pm1893 ---------------TT------------------------------------- Ph94-2 ---------------TT------------------------------------- Pa91-1b -----*A-C------TT------------------------------------- Pa3828 CCAT--A-C-----GTA---------------T-***-----------A----- Pax78123 CCAT--A-C-----GTA---------------T-***-----------A-----

Figure 3. Sequence alignment of ITS 1 regions for Pyrenophora spp. Key:-Letters/numbers to the left of the sequences are the isolate names (see Table 1); -, bases as same as for Pgx78124, *, base not present.

(Stevens EA, Blakemore EJA and Reeves JC)