Relationships amongst barley and oat infecting isolates of Pyrenophora spp. based on sequences of the internal transcribed spacer regions of ribosomal DNA Figure 4

1 70 PgX78124 GTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTT****TGTCTCTCCCCCGAGACTCGCCTTAAAAACA Pg6 ---------------------------------------------------------------------- Pg7 ---------------------------------------------------------------------- Pg11 ---------------------------------------------------------------------- Pt15 ---------------------------------------------------------------------- Pt16 ---------------------------------------------------------------------- Pt17 ---------------------------------------------------------------------- Pt18 ---------------------------------------------------------------------- Pt29 ---------------------------------------------------------------------- Pm2 ---------------------------------------------------------------------- Pm4 ---------------------------------------------------------------------- Pm857 ---------------------------------------------------------------------- Pm1881 --------------------------------------------------------C------------- Pm1892 ---------------------------------------------------------------------- Pm1893 ---------------------------------------------------------------------- Ph94-2 ---------------------------------------------------------------------- Pa91-b ---------------------------------------------------------------------- Pa3828 -------------------------------T---GTCT--GG--CG--------------------T-- Pax78123 -------------------------------T--*GTCT--GG--CGT-------------------T-- 71 140 PgX78124 TTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACATTATTTGCGCTCTTGTCCAGC*GCGGTCGCGCGT Pg6 ---------------------------------------------------------C------------ Pg7 ---------------------------------------------------------C------------ Pg11 ---------------------------------------------------------C------------ Pt15 ---------------------------------------------------------C------------ Pt16 ---------------------------------------------------------C------------ Pt17 ---------------------------------------------------------C------------ Pt18 --------------------------A------------------------------C------------ Pt29 ---------------------------------------------------------C------------ Pm2 ---------------------------------------------------------C------------ Pm4 ---------------------------------------------------------C------------ Pm857 ---------------------------------------------------------C------------ Pm1881 ---------------------------------------------------------C------------ Pm1892 ---------------------------------------------------------C------------ Pm1893 ---------------------------------------------------------C------------ Ph94-2 ---------------------------------------------------------C------------ Pa91-1b ---------------------------------------------------------C------------ Pa3828 --------------------------------------T--------T-G---T--*-*T----CA---- Pax78123 --------------------------------------T-------C--G------*-*T----CA---- 141 167 PgX78124 CCATGAAGCCTTT*TTTTTCAACCTT Pg6 -------------------------- Pg7 -------------------------- Pg11 -------------------------- Pt15 -------------------------- Pt16 -------------------------- Pt17 -------------------------- Pt18 -------------------------- Pt29 -------------------------- Pm2 -------------------------- Pm4 -------------------------- Pm857 -------------------------- Pm1881 -------------------------- Pm1892 ----------C--------------- Pm1893 -------------------------- Ph94-2 -------------------------- Pa91-1b -------------------------- Pa3828 ---------GAA---A---***-AA- Pax78123 ---------GAA---A---TTT-AA-

Figure 4. Sequence alignment of ITS 2 regions for Pyrenophora spp. Key:-Letters/numbers to the left of the sequences are the isolate names (see Table 1) ); -, bases as same as for Pgx78124, *, base not present.

(Stevens EA, Blakemore EJA and Reeves JC)