MPPOL

Abstract
Introduction
Materials & Methods
Results &
Discussion
Acknowledgements
References

Molecular Plant Pathology On-Line [http://www.bspp.org.uk/mppol/1999/0206LOTRAKUL]

Cloning of a DNA-A-like genomic component of sweet potato leaf curl virus : nucleotide sequence and phylogenetic relationships

Lotrakul P and Valverde R A
Department of Plant Pathology and Crop Physiology, Louisiana Agricultural Experiment Station, Louisiana State University Agricultural Center, Baton Rouge, LA 70803, USA.



Corresponding
author

Valverde, R.A. Department of Plant Pathology and Crop Physiology, 302 Life Sciences Bldg., Louisiana State University, Baton Rouge, LA 70803, USA. Telephone : (225)-388-1384 Fax : (225)-388-1415 E-mail:rvalver@lsuvm.sncc.lsu.edu

Approved for publication by the Director of the Louisiana Agricultural Experiment Station as manuscript number 99-38-0033.



ABSTRACT

The complete nucleotide sequence of the United States isolate of sweet potato leaf curl geminivirus (SPLCV-US) DNA-A-like genomic component was determined from three overlapping PCR clones. SPLCV-US has genome organization similar to that of monopartite begomoviruses, with six open reading frames (ORFs) and an intergenic region containing a conserved stem-loop motif. The incomplete direct repeat iterons were also found within the intergenic region with positions and arrangement similar to those of begomoviruses from the old world. The presence of the AV2 ORF also supports the relationship of SPLCV-US to old world begomoviruses. The relationships between SPLCV-US and other whitefly-transmitted geminiviruses were investigated by using phylogeny of derived AV1 and AC1 amino acid sequences. Both analyses using neighbor-joining and parsimony gave similar results. The analyses revealed that SPLCV-US has a coat protein which is unique from its counterparts from both the old and new world. Based on the AC1 amino acid sequence, SPLCV-US was found to be more closely related to begomoviruses from the old world, although its position on the phylogenetic branch is still uncertain. The relationship with other old world begomoviruses was further determined by phylogenetic analysis using the AV2 amino acid sequence which revealed that SPLCV-US is closely related to cowpea golden mosaic virus and mungbean yellow mosaic virus.



INTRODUCTION

Viruses in the family Geminiviridae are those with single-stranded DNA genomes. They can be classified into three genera based on their host plants, insect vector, and size and organization of their genomes. Subgroup I geminiviruses, or those in the genus Mastrevirus, are leafhopper-transmitted monopartite geminiviruses. Most members of this genus are monocot-infecting although a few can infect dicot plants. Dicot-infecting, leafhopper-transmitted monopartite geminiviruses are classified into the genus Curtovirus, while dicot-infecting, whitefly-transmitted bipartite geminiviruses are grouped into the genus Begomovirus (Mayo and Pringle, 1998; Padidam et al., 1995; Van Regenmortel et al., 1997).

Recent increases in whitefly populations throughout the tropical and subtropical areas have led to serious crop losses caused by several whitefly-transmitted geminiviruses. Many of these viruses are still not well characterized (Brown and Bird, 1992; Pico et al., 1996; Polston and Anderson, 1997). To provide more efficient crop protection strategies, a better understanding of the virus strains involved and their geographical distribution is needed.

In 1994, a sweet potato breeding line (W-285 from the USDA-ARS Vegetable Laboratory, Charleston, SC) showing leaf curl symptoms was collected from experimental plots in Louisiana. We determined that the causal agent was sweet potato leaf curl virus (SPLCV), a geminivirus transmitted by whiteflies (Lotrakul et al., 1998). The virus induced upward leaf curl symptoms on Ipomoea batatas. Preliminary studies using electron microscopy, Southern hybridization with cloned geminiviruses, and PCR using geminivirus-specific primers, confirmed that the United States isolate of SPLCV (SPLCV-US) was a geminivirus (Lotrakul et al., 1998).

In this study, the genome organization of a DNA-A-like genomic component of SPLCV-US was determined based on sequences obtained from three overlapping PCR clones. The relationship of SPLCV-US with other geminiviruses also was determined.


MATERIALS &
METHODS

Virus Isolates

SPLCV-US was isolated and maintained in I. setosa and I. nil as previously reported (Lotrakul et al., 1998). SPLCV-US was transferred into Nicotiana benthamiana by whitefly (Bemisia tabaci-biotype B) transmission. The presence of SPLCV-US in N. benthamiana plants with leaf curl symptoms ( Fig. 1) was confirmed by Southern hybridization (Lotrakul et al., 1998).


Fig. 1

DNA extraction and PCR
Total DNA from 1.0 g of SPLCV-US-infected N. benthamiana foliar tissue was extracted as described by Dellaporta et al. (1983). The partial genome of SPLCV-US was obtained by PCR using universal primers that amplify dicot-infecting geminiviruses (Briddon and Markham, 1994). Two pairs of primers were designed based on the partial sequence obtained from SPLCV-US. A Pst I restriction site was added onto each primer. Part of the AC1 gene was obtained by the primer PW285-1 [TAATTCGAACTGCAGTTCCGTATTTCAGTT] and PW285-2 [GCTAGAGGAGGCCTGCAGACTGCTAACGACG] while the rest of the component A DNA was obtained from the primer PW285-3 [CGTCGTTAGCAGTCTGCAGGCCTCCTCTAG] and PW285-4 [AACTGTAAATACGGAACTGCAGTTCGAATT]. The Pst I site is shown underlined. The reaction mixtures were carried out as previously described (Lotrakul et al., 1998). PCR was performed in an Amplitron® II thermocycler (Thermolyne, Dubuque, IA) with 50 cycles, each consisting of 1 min at 94°C, 1 min at 55°C, and 3 min at 72°C. A final extension step of 10 min at 72°C also was included. The PCR products were separated by electrophoresis (1.2% agarose) and stained in ethidium bromide. The amplified DNAs were recovered from agarose gels using the Ultraclean15 DNA purification kit (MO BIO laboratories Inc., Solana beach, CA). Purified PCR products were digested with Pst I and cloned into pBluescript II SK(+) (Stratagene). Restriction endonuclease and T4 DNA polymerase were used as recommended by the manufacturers. Recombinant plasmids were then transformed into competent cells of Escherichia coli strain DH5¥. Clones were screened by Southern hybridization as previously described (Lotrakul et al., 1998).

Sequence determination
The SPLCV-US DNA sequences were determined by automated sequence analysis at the DNA Sequencing Core Laboratory, University of Florida, Gainesville, FL (ABI377 DNA Sequencer; Perkin Elmer, Foster City, CA). At least three replicate clones from independent PCR reactions were sequenced to minimize any error caused by Taq polymerase. Restriction sites were analyzed using the DNAid+ program (Dardel, F., Ecole Polytechnique, Palaiseau, France) and some predicted sites were confirmed by digesting with their specific restriction enzymes. Open reading frames (ORFs) and predicted amino acid sequences were analyzed using the Translate program (ExPASy molecular biology server, Swiss Institute of Bioinformatics).

Sequence comparisons and phylogenetic analyses
The SPLCV-US nucleotide and predicted amino acid sequences were compared to those of the component A of other geminiviruses in the GenBank. Accession numbers of those geminiviruses compared in this study are listed in Table 1. Multiple sequence alignments and phylogenetic analyses using neighbor-joining and bootstrap option (1000 replicates) were carried out using version 1.7 of the Clustal w program (Thompson et al., 1994). Percent identities and similarities between aligned amino acid sequences were determined using MacDNASIS pro v1.0 programs (Hitachi Software Engineering Co. Ltd., Yokohama, Japan). Phylogenetic analyses using parsimony and bootstrap option (100 replicates) were performed with version 3.5c of Phylogeny Inference Package (PHYLIP) developed and distributed by Felsenstein, J. (Department of Genetics, University of Washington, Seattle, WA ).



RESULTS &
DISCUSSION
Cloning of the DNA-A-like genomic component of SPLCV-US
In previous studies, positive results were obtained from Southern hybridizations between total DNA extracted from SPLCV-US-infected plants and DNA-A probes from four other geminiviruses (Lotrakul et al., 1998). Attempts to clone the viral genome directly from total DNA extracted from infected plant tissue were unsuccessful (Lotrakul et al., 1998). Preliminary studies using new-world-geminivirus-derived degenerated primers gave inconsistent results. However, when universal primers for dicot-infecting geminiviruses (Briddon and Markham, 1994) were used, a consistent 1.3-kb PCR product was obtained in relatively large amounts (data not shown). This PCR product included the entire intergenic region, the complete AC4 ORF, and part of AC1 and AC2 ORF. However, the entire AV1, AV2, and AC3 and parts of AC2 ORF were replaced with a unique 40-bp sequence (data not shown).

Based on the conserved sequences within AC1 ORF, two pairs of primers were synthesized and designated PW285-1, 2, 3, and 4. These primers consistently amplified three PCR products: a 400-bp fragment (PW285-1 and 2) a 900-bp and a 2.4-kb fragment (PW285-3 and 4)(data not shown). The 400-bp and 900-bp fragments included the sequence of the 1.3-kb fragment amplified earlier. These two fragments were consistently amplified in relatively large quantities from SPLCV-US-infected tissue, but not from healthy tissue. The 2.4-kb PCR product obtained using PW285-3 and 4 primers contained the AV1, AV2, AC2, and AC3 ORFs instead of the 40-bp sequence found in the 1.3-kb fragment. This 2.4-kb fragment was amplified in relatively small amounts compared to the 900-bp fragment. With the sequences from these three overlapping clones (400-bp, 1.3-kb, and 2.4-kb), the entire DNA-A-like genomic component of SPLCV-US was assembled ( Fig. 2).


Fig. 2

 Three other pairs of overlapping primers (PW285-5 and 6, 7 and 8, and 9 and 10) were also synthesized based on the sequences in the AV1 ORF, intergenic region, and the AC1 ORF, respectively. Only a 1.3-kb PCR product was obtained by using the primers designed from the AC1 sequence (PW285-9 and 10). The sequence of this fragment was identical to the 1.3-kb fragment amplified by primers designed by Briddon and Markham (1994) (data not shown). The primers designed from the intergenic region and AV1 ORF failed to amplify the whole DNA-A-like genomic component. When these primers were used, only smears were obtained in a gel loaded with PCR products from DNA extracted from infected plants. Temperature adjustment did not improve the amplification, even when DNAs ranging from 2 to 4 kb recovered from agarose gels were used as templates (data not shown). Since mostly a 1.3-kb DNA fragment was amplified and the entire component A of SPLCV-US was seldom amplified, it is possible that this 1.3-kb DNA fragment may be a subgenomic DNA and it interferes with the amplification of the entire component A. This is supported by Southern hybridization experiments. When a full-length clone of TYLCV was used as a probe in hybridization experiments with total DNA extracted from infected plant tissues, it hybridized with two DNA fragments (2.6 and 1.3 kb) (Lotrakul et al., 1998). Similar results were obtained when the 1.3-kb DNA fragment was used to reprobe the same blot. On the contrary, when the 1-kb BamHI fragment (Fig. 3) not present in the 1.3-kb DNA fragment was used as a probe, a strong signal was detected only with the 2.6-kb DNA fragment (data not shown).


Fig. 3

 Therefore, the 1.3-kb fragment may be the subgenomic DNA produced in the host plants. There have been several reports of the presence of subgenomic DNAs in geminiviruses such as African cassava mosaic virus (ACMV) (Frischmuth and Stanley, 1991; Stanley and Townsend, 1985), tomato golden mosaic virus (TGMV) (MacDowell et al., 1986), and beet curly top virus (BCTV) (Frischmuth and Stanley, 1994; Stenger, 1994). Subgenomic DNAs of ACMV and TGMV (1.2-1.3 kb) are reported to be covalently-closed circular, single- or double-stranded DNA molecules derived from DNA B (Frischmuth and Stanley, 1991; MacDowell et al., 1986; Stanley and Townsend, 1985). The subgenomic DNAs of the monopartite BCTV are reported to be present in various sizes ranging from 0.8 to 1.8 kb (Frischmuth and Stanley, 1994). It has been suggested that these subgenomic DNAs are dependent on their complete genomes for replication and encapsidation (Frischmuth and Stanley, 1991; Stanley and Townsend, 1985). Subgenomic DNAs of these geminiviruses were found to interfere with virus proliferation, symptom development, and symptom attennuation, hence they are called defective interfering (DI) DNAs (Frischmuth and Stanley, 1994; Stenger, 1994).

Genome organization of SPLCV-US DNA-A-Like genomic component
The complete nucleotide sequence of SPLCV-US DNA-A-like genomic component consisted of 2828 bp (sequence was deposited in the GenBank database under accession number: AF104036). Based on computer analysis and comparison with other sequences in the GenBank, six ORFs with predicted protein products and an intergenic region similar to those of other begomoviruses were detected. ORFs were located on both virion sense and complementary sense strands. The genome organization and restriction map of the DNA-A-like genomic component are shown in Figs.2 and 3, respectively. The approximately 170-bp intergenic region contains a potential stem-loop sequence [GGCGGGCACCGTATTAATATTACCGGTGCCCGCC]. The underlined bases represent the potential stem structure while the bold bases represent the conserved nanonucleotide found in all geminiviruses characterized to date (Briddon et al., 1996; Padidam et al., 1995). This motif has been suggested to serve as the nick site for the initiation of viral strand DNA replication (Laufs et al., 1995). Moreover, within the intergenic region, three incomplete direct repeats of an iteron, [AATTGGAGACA], were detected near the TATA box of the AC1 ORF ( Figure 4).


Fig. 4

Another iterative element, [TGTCTCCAAAT], was detected on the other side of the TATA box. The position and arrangement of these iterative elements are similar to those of begomoviruses from the old world, as described previously by Arguello-Astorga et al. (1994).

On the virion sense strand, two ORFs encoding the predicted precoat protein and coat protein were found and designated as AV2 and AV1, respectively, according to the system modified by Padidam et al. (1995). The other four overlapping ORFs were detected on the complementary sense strand and designated as AC1, AC2, AC3, and AC4 ( Fig. 2). The presence of AV2 ORF as well as the position and orientation of the ORFs on DNA-A-like genomic component of SPLCV-US were similar to other DNA A of begomoviruses from the old world ( Hong and Harrison, 1995; Rochester et al., 1994). Based on derived amino acid sequences, relative identity and similarity between predicted protein products of SPLCV-US and their counterparts in other geminiviruses were determined. All SPLCV-US derived amino acid sequences showed low level of amino acid identities and similarities when compared to those of other characterized begomoviruses (data not shown). Of all six predicted protein products from SPLCV-US DNA-A-like genomic component, AC1 showed the highest identity while AC2 and AC3 the lowest. Based on the multiple alignments of amino acid sequences of AC1 ORF, higher amino acid identity with their corresponding sequences of geminiviruses from the old world was detected compared to those from the new world ( Table 2). The unexpectedly low amino acid similarity of AV1 (50-55%, compared to other whitefly-transmitted begomoviruses Table 2) may explain the low transmission efficiency of SPLCV-US by whiteflies which was reported in our previous study (Lotrakul et al., 1998).

Another recently described begomovirus [(Ipomoea yellow vein virus)(IYVV)] with approximately 96% amino acid (coat protein) identity with SPLCV-US could not be transmitted by three B. tabaci biotypes (Banks et al., 1999).

Phylogenetic analyses
Relationships between SPLCV-US DNA-A-like genomic component and DNA A of other begomoviruses were analyzed based on derived AV1 and AC1 amino acid sequences. AV1 and AC1 were chosen because of their high percentage of similarity among geminiviruses and the availability of the sequences in the GenBank. Furthermore, AV1 protein has been extensively used to analyze the relationships between different geminiviruses and to classify their species and strains (Briddon et al., 1996; Faria et al., 1994; Hofer et al., 1997; Hong and Harrison, 1995; Padidam et al., 1995; Paplomatas et al., 1994; Torres-Pacheco et al., 1993; Umaharan et al., 1998; Zhou et al., 1998). The AC1 and AV1 amino acid sequences of SPLCV-US were aligned with their counterparts from several geminiviruses from both the old and new world. The phylogenetic relationships were analyzed by using two methods, neighbor-joining and parsimony. Although these methods utilize different strategies in analyzing phylogenetic relationships, the results obtained were similar.

Based on AV1 and AC1 derived amino acid sequences, in all trees analyzed, the whitefly-transmitted geminiviruses cluster together in two subgroups. One group consists of geminiviruses from the old world, while the other consists of those from the new world, as previously suggested (Padidam et al., 1995). Based on the AC1 amino acid sequence, tomato pseudo-curly top virus (TPCTV) was found to be more closely related to Begomovirus than to the other member of Curtovirus, beet curly top virus. This is due to the recombinant nature of the TPCTV genome (Briddon et al., 1996). For the same reason, the new world pepper Huasteco virus (PHV) was found to cluster with the old world begomoviruses (Torres-Pacheco et al., 1993). According to the derived AV1 amino acid sequence, SPLCV-US seems to be different from the other whitefly-transmitted members of Begomovirus. Its position on the phylogenetic tree is consistent and supported by the high bootstrap numbers from both neighbor-joining and parsimony analyses (Fig. 5).


Figure 5

Figure 6

Figure 7

 When the AC1 amino acid sequence was used for phylogenetic analysis, the position of SPLCV-US seemed to be less certain. However, results from both neighbor-joining and parsimony analyses cluster it with begomoviruses from the old world (Fig. 6). The relationship between SPLCV-US and other old world begomoviruses was further investigated using derived amino acid sequences from the AV2 ORF. From the neighbor-joining tree, it seems that SPLCV-US is more closely related to cowpea golden mosaic virus (CPGMV) and mungbean yellow mosaic virus (MYMV) while it is clearly distinct from most of the other old world begomoviruses compared in this study(Fig. 7).

Different relationships between SPLCV-US and other begomoviruses observed based on derived amino acid sequences from different ORFs suggest the possibility of prior recombination events. Some geminiviruses such as BCTV, Horseradish curly top virus, TPCTV, and PHV have been suggested to have emerged from recombination of different viral genomes (Briddon et al., 1996; Klute et al., 1996; Torres-Pacheco et al., 1993). It is also possible that SPLCV-US might share a common ancestor with the old world geminiviruses and may have diverged independently generating unique characteristics of its own.

The overall analysis of SPLCV-US DNA-A-like genomic component presented here confirms that SPLCV-US is a member of Begomovirus (Lotrakul et al., 1998). In this study, we still were not able to determine if DNA B exists. Negative results were detected when the full-length clones of DNA B from BGMV, PHV, and ToMoV were used as specific probes (Lotrakul et al., 1998). Moreover, attempts to amplify DNA B of SPLCV-US using degenerate primers (Idris and Brown, 1998; Rojas et al., 1993) were not successful (data not shown). Similarly, Banks et al. (1999) could not determine whether or not DNA B exists for IYVV, another Ipomoea-infecting begomovirus. However, we could not rule out the possibility that DNA B was present due to low sequence identity between SPLCV-US and other members of Begomovirus. Further studies are in progress to determine whether SPLCV-US is a bipartite geminivirus.

Recently, a partial sequence of an isolate of SPLCV from Japan has been published (Onuki and Hanada, 1998). However, based on the iterative sequences in the intergenic region (Fig. 4) and the symptoms induced on Ipomoea sp., it appears that SPLCV-US is different from the Japanese isolate. Further comparison of the entire component A sequence and phylogenetic analyses of these two viruses will lead to a better understanding of relationships among different sweet potato geminiviruses.



ACKNOWLEDGE
-MENTS

The authors thank C. A. Clark and A. Landry (Louisiana State University) for suggestions to the manuscript; M. M. Blackwell and S. O. Suh (Louisiana State University) for advice in phylogenetic analyses; S. Chadchawan (Chulalongkorn University, Bangkok, Thailand) for sequence homology analyses; R. W. Briddon (John Innes Centre for Plant Science Research, Norwich, UK) for technical advice; and the Louisiana Sweet Potato Advertising and Development Commission for financial support.

REFERENCES

Arguello-Astorga GR, Guevara-Gonzalez RG, Herrera-Estrella LR, Rivera-Bustamante RF, 1994. Geminivirus replication origins have a group specific organization of iterative elements : A model for replication. Virology 203, 90-100

Banks GK, Bedford ID, Beitia FJ, Rodriguez-Cerezo E, Markham PG, 1999. A novel geminivirus of Ipomoea indica (Convolvulacae) from Southern Spain. Plant Disease 83, 486

Briddon RW, Bedford ID, Tsai JH, Markham PG, 1996. Analysis of the nucleotide sequence of the treehopper-transmitted geminivirus, tomato pseudo-curly top virus, suggests a recombinant origin. Virology 219, 387-394

Briddon RW, Markham PG, 1994. Universal primers for the PCR amplification of dicot-infecting geminiviruses. Molecular Biotechnology 1, 202-205

Brown JK, Bird J, 1992. Whitefly-transmitted geminiviruses and associated disorders in the Americas and the Caribbean basin. Plant Disease 76, 220-225

Dellaporta SL, Wood J, Hicks JB, 1983. A plant DNA minipreparation: Version II. Plant Molecular Biology Reporter 1, 19-21

Faria JC, Gilbertson RL, Hanson SF, Morales FJ, Ahlquist P, Loniello AO, Maxwell DP, 1994. Bean golden mosaic geminivirus type II isolates from the Dominican Republic and Guatemala : nucleotide sequences, infectious pseudorecombinants, and phylogenetic relationships. Phytopathology 84, 321-329

Frischmuth T, Stanley J, 1991. African cassava mosaic virus DI DNA interferes with the replication of both genomic components. Virology 183, 539-544

Frischmuth T, Stanley J, 1994. Beet curly top virus symptom amelioration in Nicotiana benthamiana transformed with a naturally occurring viral subgenomic DNA. Virology 200, 826-830

Hofer P, Engel M, Jeske H, Frischmuth T, 1997. Nucleotide sequence of a new bipartite geminivirus isolated from the common weed Sida rhombifolia in Costa Rica. Journal of General Virology 78, 1785-1790

Hong YG, Harrison BD, 1995. Nucleotide sequences from tomato leaf curl viruses from different countries : evidence for three geographically separated branches in evolution of the coat protein of whitefly-transmitted geminiviruses. Journal of General Virology 76, 2043-2049

Klute KA, Nadler SA, Stenger DC, 1996. Horseradish curly top virus is a distinct subgroup II geminivirus species with rep and C4 genes derived from a subgroup III ancestor. Journal of General Virology 77, 1369-1378

Idris AM, Brown JK, 1998. Sinaloa tomato leaf curl geminivirus: Biological and molecular evidence for a new subgroup III virus. Phytopathology 88, 648-657

Laufs J, Jupin I, David C, Schumacher S, Heyraud-Nitschke F, Gronenborn B, 1995. Geminivirus replication : Genetic and biochemical characterization of Rep protein function, a review. Biochimie 77, 765-773

Lotrakul P, Valverde RA, Clark CA, Sim J, De La Torre R, 1998. Detection of a geminivirus infecting sweet potato in the United States. Plant Disease 82, 1253-1257

MacDowell SW, Coutts RHA, Buck KW, 1986. Molecular characterisation of subgenomic single-stranded and double-stranded DNA forms isolated from plants infected with tomato golden mosaic virus. Nucleic Acids Research 14, 7967-7984

Mayo MA, Pringle CR, 1998. Virus taxonomy-1997. Journal of General Virology 79, 649-657

Onuki M, Hanada K, 1998. PCR amplification and partial nucleotide sequences of three dicot-infecting geminiviruses occurring in Japan. Annals of the Phytopathological Society of Japan 64, 116-120

Padidam M, Beachy RN, Fauquet CM, 1995. Classification and identification of geminiviruses using sequence comparisons. Journal of General Virology 76, 249-263

Paplomatas EJ, Patel VP, Hou Y-M, Noueiry AO, Gilbertson RL, 1994. Molecular characterization of a new sap-transmissible bipartite genome geminivirus infecting tomatoes in Mexico. Phytopathology 84, 1215-1224

Pico B, Diez MJ, Nuez F, 1996. Viral diseases causing the greatest economic losses to the tomato crop. II. The tomato yellow leaf curl virus-a review. Scientia Horticulturae 67, 151-196

Polston JE, Anderson PK, 1997. The emergence of whitefly-transmitted geminiviruses in tomato in the western hemisphere. Plant Disease 81, 1358-1369

Rojas MR, Gilbertson RL, Russell DR, Maxwell DP, 1993. Use of degenerate primers in the polymerase chain reaction to detected whitefly-transmitted geminiviruses. Plant Disease 77, 340-347

Rochester DE, DePaulo JJ, Fauquet CM, Beachy RN, 1994. Complete nucleotide sequence of the geminivirus tomato yellow leaf curl virus, Thailand isolate. Journal of General Virology 75, 477-485

Stanley J, Townsend R, 1985. Characterisation of DNA forms associated with cassava latent virus infection. Nucleic Acids Research 13, 2189-2206

Stenger DC, 1994. Strain-specific mobilization and amplification of a transgenic defective-interfering DNA of the geminivirus beet curly top virus. Virology 203, 397-402

Thompson JD, Higgins DG, Gibson TJ, 1994. Clustal W : Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-4680

Torres-Pacheco I, Garzon-Tiznado JA, Herrera-Estrella L, Rivera-Bustamante RF, 1993. Complete nucleotide sequence of pepper huasteco virus : analysis and comparison with bipartite geminiviruses. Journal of General Virology 74, 2225-2231

Umaharan P, Padidam M, Phelps RH, Beachy RN, Fauquet CM, 1998. Distribution and diversity of geminiviruses in Trinidad and Tobago. Phytopathology 88, 1262-1268

Van Regenmortel MHV, Bishop DHL, Fauquet CM, Mayo MA, Maniloff J, Calisher CH, 1997. Guidelines to the demarcation of virus species. Archives in Virology 142, 1505-1518

Zhou X, Liu Y, Robinson DJ, Harrison BD, 1998. Four DNA-A variants among Pakistani isolates of cotton leaf curl virus and their affinities to DNA-A of geminivirus isolates from okra. Journal of General Virology 79, 915-923