Tobacco streak virus infecting faba bean (Vicia faba) reported for the first time

M.A. Ali*¹, S. Winter² and G. A. Dafalla³

¹ Plant Pathology Centre, Faculty of Agricultural Sciences, Gezira University, Sudan
² Plant Virus Department, Deutsche Sammlung von Mikroorganismen und Zellkulturen, Messeweg, Braunschweig, Germany
³ Plant Pathology Centre, Faculty of Agricultural Sciences, Gezira University, Sudan

*maiadil@yahoo.com

Accepted for publication 08/04/08

During the period December 2005 to January 2006, unusual leaf symptoms suggestive of a virus infection were observed in faba bean (Vicia faba) in fields in the Gezira area and Northern parts of Sudan.  Symptoms in beans were coincident with a high level of crop infestation by Aphis craccivora that might play a role in the transmission of the virus.

Figure 1 (left):  severe leave chlorosis caused by TSV on faba bean; Figure 2 (middle): browning and blackening of  faba bean leaves caused by TSV; Figure 3 (right): death of faba bean plant due to TSV infection

Chlorotic mottling and/or mosaic symptoms were accompanied by black streaks on stems and leaf petioles. In some bean varieties, severe leaf chlorosis (Fig. 1) subsequently developed into browning and blackening of the entire leaves (Fig. 2), resulting in plant death (Fig. 3).

Extracts from bean leaves were mechanically inoculated on to range of host plants, and Nicotiana benthamiana and Chenopodium quinoa were identified as suitable propagation hosts. Electron microscope analysis of leaf extracts from infected Chenopodium quinoa revealed virus-like particles with isometric particles approximately 30 nm in diameter.

A specific antiserum raised against the purified virus was produced, and in Western-immunoblot analysis the size of the putative coat protein was estimated to be between 29 and 30 kDa.  Using several reference viruses available at the DSMZ collection in Braunschweig, Germany, for a serological comparison, the virus isolated from faba bean was found to be related to Tobacco streak virus (TSV) (Scott, 2001), a virus that is a serious pathogen of groundnut, sunflower and okra in India (Reddy et al., 2002; Bhat et al., 2002; Krishnareddy et al., 2003). The identity of the faba bean virus isolate was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and sequence analysis. A fragment of 717 nucleotides corresponding to the complete TSV coat protein region was sequenced by using specific TSV primers (TSV Cps ATGAATACTTTGATCCAAGG–TSVCPcTCAGTCTTGATTCACCAGGA) (GenBank Acc. No. CAP71888). A comparison of the deduced 237 aa coat protein sequence revealed between 90 and 92 % sequence identity with the coat proteins of TSV isolates from sunflower, cotton and a number of other crops in India (ABU55372 , AY061928 and  AF515824). The closest relationship (98% aa cp identity) of TSV from the Sudan was found with a TSV isolate from the ornamental Impatiens neuguinea (DSMZ PV-0909, origin unknown). An analysis of TSV isolates from legumes including Vicia faba revealed a 92% amino acid sequence identity with a soybean isolate from India (ABM 53867) and only a distant relationship to a TSV soybean isolate from Brazil (AAQ 99137, 83%). This shows a distinct geographic distribution of the TSV isolates from faba bean in Sudan. 

To our knowledge this is the first report of the natural occurrence of TSV in Vicia faba.  

References

Reddy AS , Prasada Rao RDVJ, Thirumala-Devi K, Reddy SV, Mayo M A, Roberts I, Satyanarayana T, Subramaniam K, ReddyDVR, 2002. Occurrence of Tobacco streak virus on peanut (Arachis hypogaea) in India. Plant Disease 86, 173-178.

Bhat AL, Jain RK, Kumar A, Ramiah M, Varma A, 2002. Serological and coat protein sequence studies suggest that necrosis disease on sunflower in India is caused by a strain of Tobacco streak ilarvirus. Archives of Virology 147, 651–658.

Krishnareddy M, Salil J, Samuel DK, 2003. Fruit Distortion Mosaic Disease of Okra in India. Plant Disease 87, 1395.

Scott SW, 2001. Tobacco streak virus. Descriptions of Plant Viruses No 381. Warwick, UK: Association of Applied Biologists.