R.A. Mumford*, R. Glover, M. Daly, T. Nixon, V. Harju and A. Skelton
Central Science Laboratory (CSL), Sand Hutton, York, YO41 1LZ, UK
*r.mumford@csl.gov.uk
Accepted for publication 03 Jan 2008
In June 2007, a sample of leaves was received from a year-round crop of Lisianthus (Eustoma grandiflorum) growing under glass in Suffolk, England. The sample exhibited necrosis, mainly observed as pale, necrotic lesions (Fig. 1). In the worst affected block up to 20% of plants were reported as showing similar symptoms. A test performed by another laboratory had previously detected Iris yellow spot virus (IYSV) in the symptomatic plants. To confirm this diagnosis officially, an ELISA test was performed using an IYSV polyclonal DAS-ELISA kit (Loewe, Germany). This test was positive. The result was confirmed using a new real-time PCR (TaqMan®) assay (Forward Primer (DQ658242-524F): TCCAGAATGTGAAAAAAGAAGCACT; Reverse Primer (DQ658242-524R): TGCCATGACTCTTGCAACTTTG; MGB Probe (DQ658242-552T): TATAAGCAGATTCTCAA CTTA). This new assay was designed using an available IYSV nucleocapsid (NC) protein gene sequence (GenBank Acc. No. DQ658242) and further alignments against 45 other IYSV sequences available on public databases. It was validated with 4 known IYSV isolates; one purchased from Loewe, Germany and three kindly supplied by Ko Verhoeven, PPS, The Netherlands. Total RNA extraction (CTAB method) and real-time PCR assay conditions were essentially as described previously (Mumford et al., 2004).
For further confirmation, conventional RT-PCR was performed using IYSV-specific primers (Pappu et al., 2006), on extracts made from leaf material with symptoms. A product of the correct predicted size (822 bp) was obtained and sequenced. The deduced NC gene sequence obtained (Acc. No. AM900393) was analysed and shown to share at least 84% nt identity with all other IYSV NC sequences; the highest homology (98%) being with a Dutch isolate from Iris hollandica (Acc. No. AF001387).
Widely distributed around the world in onion and leek crops (Jones, 2005; EPPO, www.eppo.org/ QUARANTINE/Alert_List/viruses/IYSV00.htm), IYSV has been identified in various ornamental crops, including Lisianthus (Kritzman et al., 2000). However, this is the first finding of IYSV in the UK. The infected crop has now been removed and measures taken to eradicate the infection.
Jones DR, 2005. Plant viruses transmitted by thrips. European Journal of Plant Pathology 113, 119-157.
Kritzman A, Beckleman H, Alexandrow S, Cohen J, Lampel M, Zeidan M, Raccah B, Gera A, 2000. Lisianthus leaf necrosis: a new disease of Lisianthus caused by iris yellow spot virus. Plant Disease 84, 1185-1189.
Mumford RA, Skelton A, Metcalfe E, Walsh K, Boonham N, 2004. The reliable detection of Barley yellow and mild mosaic viruses using real-time PCR (TaqManâ). Journal of Virological Methods 117, 153-159.
Pappu HR, du Toit LJ, Schwartz HF, Mohan SK, 2006. Sequence diversity of the nucleoprotein gene of iris yellow spot virus (genus Tospovirus, family Bunyaviridae) isolates from the western region of the United States. Archives of Virology 151, 1015-1025.